Which statement about the three domains of life is TRUE? Archaea is most closely related to Bacteria. Archaea is most closely related to Eukarya. Bacteria is most closely related to Eukarya. Bacteria and Archaea are equally related to the Eukarya. Bacteria and Archaea have no evolutionary relationship to Eukarya.

Q: Livestock Breed Identifi - Student Notes 39. Maine-Anjou Origin: France in the early 19th century,…

A: Introduction Maine-Anjou:- The Maine-Anjou is a French breed of domestic cattle, is traditionally…

Q: Make a situation on how an organism (plant/animal) maintains homeostasis.

A: Homeostasis It is defined as the ability of the organism to maintain a constant and stable internal…

Q: Which are considered Zoonotic diseases? Select all that apply. O Ebola O HIV O Rabies Hantavirus…

A: Disease is a kind of harmful condition which disturb or impairs functioning of body part or whole…

Q: 1. What do ascaris lumbricoides egg look like? 2. How can it infect a person? 3. How to prevent its…

A:

Q: Order Ca2+, CO2, ethanol, glucose, RNA, and H2Oaccording to their ability to diffuse through a lipid…

A: The lipid bilayer is composed of biological membranes and is composed of two layers of…

Q: How can the information for specifying an organism be carried in chemical form, and how can the…

A: The ability to store and transmit information is crucial for the survival of any organism. In order…

Q: Question 9 What structural features are true regarding the transmembrane and cytoplasmic domains?…

A:

Q: In ecological systems, a rough rule of thumb is that when energyis transferred from plants to…

A: Food chains and food webs are the means of energy transfer in the ecosystem.

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: - Student Notes 42. Marchigiana Size: large breed with heavy fine bone structure and strong feet and…

A:

Q: Key properties of proteins include: O a. A wide range of functional groups and an ability to possess…

A: A protein is the large biomolecule (macromolecule)made up of amino acids subunits.

Q: Match the viruses with the diseases that they cause: Human Immunodeficiency virus Herpes zoster H1N1…

A: Viruses are the connecting link between the living and the non living. These have some properties of…

Q: Why is glucose provided by glycogenolysis in the liver but not in skeletal muscle?

A: Through glycogenolysis process, glycogen broken down into glucose and provide energy.  Muscle…

Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…

A: Mutation is a permanent variation of some nucleotide sequences in an organism's genome that can…

Q: To examine: Whether the statement "All flowers are pollinated by bees" is true or false.

A: A flower is the reproductive part of an angiosperm plant's modified thick shoot. The transfer of…

Q: 26 Using the diagram below, describe the changes that occur if a fertilised egg becomes implanted in…

A: A multitude of factors must come together in order for a baby to be born. The development of a human…

Q: How is a child with Type I diabetes similar to a child who is starving? Mark all that apply 2 Both…

A: Type 1 diabetes is a chronic disease with elevated blood glucose levels, in this case, the pancreas…

Q: To explain: The way in which the shortened telomeres affect the life-span of IPSCS and…

A: Stem cells are an undifferentiated mass of cells that can differentiate into specific cell types.…

Q: Why does the plasma membrane of a cell present a barrier to the movement of electrolytes through it?…

A: Introduction - The plasma membrane is a thin lipid bilayer that surrounds and protects the cell's…

Q: Which characteristic do all prokaryotic and eukaryotic cells share? They contain a nucleus. They…

A: Prokaryotes are single-celled microscopic organisms that are divided into two distinct groups: the…

Q: Blue feather color is dominant to brown feather color. Which of the following statements is true…

A: Dominant and Recessive alleles Dominant alleles are those that mask the expression of other alleles…

Q: Why is Endo Agar is recommended for membrane filtration experiment and not TSA plate?

A: Membrane filtration is a water sample testing technique. Water is drawn through a specific porous…

Q: A. Fill in the table by comparing the following biological molecules. Biological Molecules Basic…

A: Every living organisms have cells which is the smallest structure and functional unit of the…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: Which steps are part of the energy investing half of glycolysis? Phosphorylation Isomerization…

A: Here i will discuss the steps involved in energy investment during glycolysis.

Q: Briefly exaplain bacterial genetics and the operon organization of genes concept.

A: Bacterial genetics is the study of heritable information systems in bacteria, including their…

Q: Which stage of mitosis is shown in the picture? Prophase Telophase Metaphase Anaphase

A: Mitosis is equational division. Meiosis is reductional division.

Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines

A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…

Q: Is the plant with the yellow flower above a eudicot or a monocot? What about the plant with the…

A: * The plant with yellow flower is comes under eudicot. * This yellow flower bearing plant is called…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…

Q: Why do some biologists think that the apicomplexans descended from dinoflagellates?

A: The finding of a nonphotosynthetic plastid in malaria and other apicomplexan pathogens has prompted…

Q: bu generate mutants in the metabolic pathway for starlase. You conduct some complementation sts…

A: A complementation test is used to determine whether two mutations present at the same locus or at…

Q: Why might high concentrations of urea unfold proteins?

A: The organic molecule urea, commonly known as carbamide, has the chemical formula CO(NH2)2. A…

Q: Which of these statements about taste is true? All bitter-tasting compounds have a similar chemical…

A: Taste buds are peripheral organs of gustation that are primarily found in the tongue epithelium but…

Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…

A: The answer is  1.17 mL of cells and 3.83 mL of medium

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A: Ans - The three types of modifications that mRNA undergoes in eukaryotes before the mRNA is…

Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…

A: Ascaris is commonly known as roundworm. It belongs to phylum nematoda.

Q: With only one exception, the most commonly used STR loci are spread across the human genome, each on…

A: The most common short tandem repeat (STRs) inside the human genome are dinucleotide repeats. STR…

Q: Where on the cladogram would you place the common ancestor of brown algae and water molds? The…

A: A cladogram is a diagram that shows the evolutionary relationships between organisms. It is used to…

Q: Describe how thermodynamics and metabolism are related.

A: According to first law of thermodynamics energy can neither be created nor destroyed. Though it can…

Q: A patient's cardiac output is measured as 5849.58 mL/min using the Fick's method. The spirometer…

A: Fick's concept allows for extremely precise cardiac output calculations. In the tissues, total…

Q: Which of the following is false? a. Stems have vascular bundles, and roots have vascular cylinders.…

A: Botany, often known as plant science, plant biology, or phytology, is a discipline of biology that…

Q: O c) Frameshift mutation

A:

Q: QUESTION 50 Expression of the maternal vs paternal alleles for the Igf2 gene is determined by: O…

A: 50. Expression of the maternal vs paternal allele for the Igf2 gene is determine byimprinting…

Q: A _______ response is when the immune system responds faster upon second encounter with an antigen.

A:

Q: How are the alleles of a gene different from each other? What is its importance?

A: Alleles are different variants of the same gene that are genetically different . For example, a gene…

Q: What is the difference between the heart sounds of lupp and dupp?

A: Lub and dup are cardiac sounds that can be detected with a stethoscope placed on the chest just…

Q: Fill in the purity reading of each either good or bad sample as well as the remarks what makes the…

A: There are few important points: RNA is synthesized by four types of ribonucleotides and joined by…

Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…

A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…

Q: Question 2 1 pts The nundber and size of organelles in a cell correlates with that cell's function.…

A: Microtubule along with intermediate fillament and microfillament form cell cytoskeleton.…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.