A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below.DNADNAATG CCT TGT GẠCATG CCT TGA GẠCtranscriptiontranscriptionMRNAMRNAAUG CCU UGU GACAUG CCU UGA GACoriginal sequencemutated sequenceWhat kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above?O A. Silent MutationB. ChromoC. Nonsense MutationD. Frameshift Mutation The chart below shows the codons that make up the genetic code and the sequence of nucleotides that corresponds to them.Second Base in CodonFirst BaseThird Basein Codonin CodonAGUAUUCUUuC Phe ucclUCAUCGTyr UGcCysUACSerUAA Stop UGA StopUUUAUUG LeuCCUUAGStop UGG TrpCUUCUCccCUA LeuCCAcCGCAU| HisCACProCAACAGCGUCGCICGAArgGinCUGCGGGAUUAUC lleAUAAUG Met ACGGUUGUCACUACCACAAAUAAC AsnAGUAGC SerAGAUThrAAA),AAG Lys AGG ArgAGAUAspGACGCUGGUGGCGlyGCCValGUAAlaGAAGGCAGCGGGAGluGUGGAGGGG

Name: A mistake during DNA replication leads to a mutation in the nucleotid
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below.DNADNAATG CCT TGT GẠCATG CCT TGA GẠCtranscriptiontranscriptionMRNAMRNAAUG CCU UGU GACAUG CCU UGA GACoriginal sequencemutated sequenceWhat kind of mutation wi

Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…

Science

Biology

A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GAC| ATG CCT TGA GAC| | transcription transcription MRNA MRNA AUG CCU UGU GẠC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation O B. Chromo O C. Nonsense Mutation O D. Frameshift Mutation

A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GAC| ATG CCT TGA GAC| | transcription transcription MRNA MRNA AUG CCU UGU GẠC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation O B. Chromo O C. Nonsense Mutation O D. Frameshift Mutation

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 15SA: Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar,...

See similar textbooks

Similar questions

The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA polymerase proofreading c. nucleotide excision repair d. thymine dimers
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
A fragment of DNA has the sequence 5'-ATCCGCT-3'. Following DNA replication, the complementary strand is 3'-TAAGCGA-5'. What type of mutation occurred? a. Frameshift b. Transversion c. Pyrimidine dimer d. Transition
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT
What type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertion
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C.
6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.