A point mutation is a mutation that arises when one nucleotide in the genetic sequence is substituted, added or deleted. Two possible point mutations are given below: Mutation A. Lysine is substituted for Leucine Mutation B: Serine is substituted for Threonine Which mutation is likely to be more serious? E Explain

A point mutation is a mutation that arises when one nucleotide in the genetic sequence is substituted, added or deleted. Two possible point mutations are given below: Mutation A. Lysine is substituted for Leucine Mutation B: Serine is substituted for Threonine Which mutation is likely to be more serious? E Explain

Name: A point mutation is a mutation that arises when one nucleotide in the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A point mutation is a mutation that arises when one nucleotide in the geneticsequence is substituted, added or deleted.Two possible point mutations are given below:Mutation A. Lysine is substituted for LeucineMutation B: Serine is substituted for Th

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation
Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
A mutation caused by a base deamination or a tautomerization is called a a. silent mutation b. transition mutation c. nonsense mutation d. missense mutation
I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
a. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?
A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutation
Which of the following is/are a transition mutation(s)? (select any that apply) A to T A to G C to G A to C C to A
Figure 2 illustrates a type of gene mutation. a) State the type of gene mutation shown in Figure 2. b) Name the genetic disorder that would arise from this mutation. c) What is the difference(s) between gene mutation shown in Figure 2 from a frameshift mutation?
An alien visits Earth and is found to have the same 'genetic code' as humans. However, the alien has many more 'stop' codom which replace codoes that are redandant in the human genetic code. If nucleotide substitution errors occur at the same rate for aliens and humans, the aliens would have many more of whichkind of mutations?a.) missense mutation only b.) silent mutations only c.) nonsense mutations only d.) antisense mutations only e.) silent and missence mutations