Q: Triethylenemelamine (TEM) is an antitumor agent. Its activity is due to its ability to cross-link…
A: The triethylenemelamine (TEM) is an alkylating agent whoes main power lies in the triple three…
Q: 1. How does real-time polymerase chain reaction work? 2. How is SYBR Green used in the experiment?
A: Solution: Answer: 1) How does real-time polymerase chain reaction work? Definition of real-time…
Q: Which of the following functional groups are in the following DNA strand: 5'-CATTTGAACTG-3'?…
A: Nucleotides are linked by phosphate diester groups . Adenine, guanine, and cytosine have amine group…
Q: The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine is 9.50. Explain this…
A:
Q: 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish…
A: DNA is basically a genetic material and transfer genetic information necessary for synthesis of…
Q: The 13C nucleus never couples with the 'H nucleus. True False
A: we have the state the given statement is true or false
Q: One of the most advanced methods for determining a protein sequence is tandem mass spectrometry…
A: Tandem mass spectroscopy includes the coupling of two or more mass analyzers to significantly…
Q: Given below is a sequence of DNA. Complete its complementary strand. 5’ AGCCCTGACGTGCCAGT 3’
A: Base complementary rules: Adenine pairs with Thymine Guanine pairs with Cytosine Cytosine pairs…
Q: Draw the structure of a four-residue segment of DNA with the following sequence.(3′end) G@T@A@C (5′…
A: The structure of a four-residue segment of DNA for the given sequence is shown below.
Q: In mass spectrometry, alpha cleavages are common in molecules with heteroatoms. Draw the two…
A: Two alpha cleavages in the given molecule is represented as
Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…
A:
Q: A mutation in a/an _____ sequence of a gene would be associated with excessive mRNA length. A)…
A: In some genes, not all of the DNA sequence is used to make protein. Introns are noncoding sections…
Q: What is a matching sequence of bases for ‘UTAG’ using Watson-Crick base pairing? Why is this…
A: In the Watson-Crick model, Adenine binds with Thymine (A-T) or Uracil (A-U) and Cytosine bind with…
Q: Which is strong bp-bp repulsion or bp-lp repulsion?
A: According to Valence Shell Electron Pair Repulsion Theory, the shape or structure of a molecule is…
Q: NH2 HN-DNA H,N-DNA N-DNA OCH, HN. HN-DNA H,C NH H,C NH2 Mitomycin C DNA adduct Mitomycin C is an…
A: The mechanism for this goes as follows.
Q: The basic principle that underlies northern and Southern blots is .…
A: We will choose correct option
Q: What is the percent guanine in a DNA molecule containing 26% adenine? O 24% O26% 52% 48%
A: Given Percentage of Adenine in DNA = 26 % Percentage of Guanine in DNA = x = To be determined
Q: In the experiments of Barrick et al. (as shown), it was observed thatreplacement of histidine by a…
A: Hemoglobins have two alpha chains and two beta chains. When oxygen binds hemoglobin, there is a…
Q: A pioneer in designing and synthesizing antimetabolites that could destroy cancer cells was George…
A: Biomolecules play a very important role in our body. They exist in different forms depending upon…
Q: Why is the DNP compound coloured?
A:
Q: 1H 19F has a force constant of 966 N m-1. Calculate the frequency of light corresponding to the…
A: In infrared spectroscopy, the infrared radiation interacts with the molecule to give the spectra.…
Q: Exposure to nitrous acid (see Section 19-16), sometimes found in cells, can convert cytosine to…
A: (a)
Q: 3. The nucleotide solution absorbs UV light and absorbance at 260 nm is A(260)=0.64 when measured in…
A: Please find your solution below : According to Lambert beers law, the absorbance of light is…
Q: OCH3 2) a) Of the compound above, show homotopic carbon nuclei by numbering the homotopic groups.
A: The term topicity deals with the obtained stereochemical relationship that arises due to the…
Q: The polypeptide LMKYTNMRLEDTRYND is hydrolyzed by trypsin for sequencing. This will result in how…
A: Proteins are polypeptides, polymers made up of a large number of amino acids joined together by…
Q: Which of the following tentative base-pairs (designated A-F) actually exist in a double-stranded DNA…
A: The solution is given below -
Q: What type of organic compounds can be detected using GC-MS?
A:
Q: Are the following compounds correct? These may OR may not be correct. Please look them over and…
A: (a) The structure of the given tRNA molecule is correct but the word valine written on the top is…
Q: Replicate, transcribe and translate the DNA strand below. Be sure to label your 5’ and 3’ ends and…
A: DNA is Deoxyribonucleic acid. It is the genetic material of higher organisms. It has double stranded…
Q: ANALYSIS The anticodon on one tRNA which carries histidine to the site of protein synthesis is CAU.…
A: Given information, The anticodon on one tRNA which carries histidine to the site of protein…
Q: Determine the pl for this synthesized pentapeptide: A-B-C-D-E Given that the pK values for the amino…
A: Amino acid are biomolecules which have both acidic and and basic group We are required to find the…
Q: NH2 H2N-DNA- H -N-DNA- H H2N-DNA- H2N OCH3 H2N. HN-DNA H3C NH H3C "NH2 Mitomycin C DNA adduct…
A: Reaction mechanism: A chemical reaction occurs by the sequence of elementary steps is called…
Q: 4
A: DNA strands are negatively charged so, they are attracted by the positive electrode. In gel…
Q: temperature of 45 °C for 15 seconds in a PCR reaction is needed for A The two strands of DNA…
A: Second step in PCR reaction is primer annealing step. In this step, the temperature is brought down…
Q: A sample of chromatin was partially digested by the enzyme staphy- lococcal nuclease. The DNA…
A: Using Marker DNA fragment a graph is drawn. The graph is log of DNA size vs distance migrated.
Q: _has emerged as a technique for protein sequencing. Select an answer and submit. For keyboard…
A: Given: Protein sequencing To find: Technique for protein sequencing Solution: Proteins are made up…
Q: 9. For the DNA segment with nucleotide sequence 5' TATCGC 3', how many hydrogen bonds in total hold…
A: 9. Total number of hydrogen bonding is 15. As there are two hydrogen bonding between A , T and there…
Q: This technique uses the principle of isoelectric point to separate a mixture of proteins into its…
A: 1. Electrophoresis : Neutral amino acid contains one -COOH and one -NH2 groups. Hence, they exist as…
Q: Indirate ahether cochAthe 7dlawings ICharactersticA the7issionncrFusion prcos B7ission g Ausion. "A…
A: Fission is defined as a process in which splitting of a heavy and unstable nucleus into two lighter…
Q: Find the pKa Values of attached Carbon Acids:
A: The acidity is the property of the molecules to lose H+ ions in the solution. The acidity of the…
Q: What is Svedberg coefficient ? How is used for DNA ?
A: The Svedberg constant is a measure of time, defined as exactly 10−13 seconds (100 fs). For all…
Q: A double-stranded DNA has 7602 base pairs with base composition of 10% G+C. How many thymine…
A: How many thymine residues are there in this DNA? = 3421
Q: ह अगैामेना ।ति 45्का ी ०.4 m - NdoH meकवटिट \S mL to Hत्J, whad mu be the motarity what mu be कए…
A:
Q: What is NOT a feature of PCR? O a. The target can be much larger than the primers. Ob. Primers do…
A: the goal of PCR is to make enough of the target DNA region that it can be analyzed or used in some…
Step by step
Solved in 3 steps
- Which will have higher fluorescence intensity? A. 32 bp DNA segment B. 18 bp DNA segmentWhat is the Hrxn in kJ? what is the Srxn in kJ?1. The slope of a standard curve of Abs vs [protein] is equalivent to which Lambert-Beer variable? A.) OD B.) ϵ C.) c D.) D 2.) DNA absorbs light around 260 nm. What wavelength do proteins absorb? A.) 625 nm B.) 140 nm C.) 240 nm D.) 280 nm
- what is the resolution?What are the types of MSDS forms.SHOW COMPLETE SOLUTIONS Q8. From 5 mL gDNA solution, 1 mL aliquot was diluted with sterile DNA gradevwater to a final volume of 5 mL. If the absorbance measured at A260 and A280 are 0.587 and 0.309, respectively (assuming that the solution is not turbid), what is the concentration of DNA sample in the original stock solution?