Q: Which DNA double helix do you think would be harder to separate into two strands? DNA composed of…
A: DNA DNA or Deoxyribonucleic acid is a genetic molecule that made up of two polynucleotide chains.…
Q: Using your own words and including the phrases “5' to 3" and "3' to 5" explain how a double helix of…
A: The genetic material of many species, including humans, is DNA, or deoxyribonucleic acid. The…
Q: Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent…
A: A G T A C C G G G C A A the sequence of DNA
Q: During gel electrophoresis, DNA molecules can easily be separated according to size because all DNA…
A: Introduction Gel electrophoresis is very well known and efficient technique to separate out DNA/RNA…
Q: Which is NOT a difference between RNA and DNA? A. RNA contains uracil; DNA usually does not.…
A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that loop around one…
Q: Bonding between complementary bases Weak hydrogen bonds form between complementary base pairs. The…
A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…
Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…
A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…
Q: Would you expect RNA molecules to behave in the same manner as DNA during gel electrophoresis? Why…
A: Gel electrophoresis is the technique where macro molecules especially proteins and nucleic acid are…
Q: explain how the biochemical structure of DNA allows it to function as the genetic materia
A: Introduction: Deoxyribonucleic acid, or DNA, is a molecule that provides the genetic instructions…
Q: DNA is an attractive option for long-term data storage because hydrogen bonding between single…
A: Need to find whether the DNA is a good option to store data or not.
Q: Make up your own DNA palindrome, of at least 6 bases long.
A: PALINDROME: The word 'palindrome' symbolizes number, phrase and sequence of characters…
Q: DNA molecules move towards the positive pole of the electric field during gel electrophoresis. Which…
A: Gel electrophoresis is the genetic engineering and molecular biology laboratory technique that is…
Q: How Can Fragments of DNA Be Separated From One Another? Agarose gel electrophoresis is a procedure…
A: Note- as we are allowed to only 3 subparts of a question, i can provide answers for first three…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'
A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…
Q: . Other polar molecules include nucleic acids and some proteins. Look at the DNA sketch provided and…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: Biochemist Erwin Chargaff was the first to discover that, in DNA, [A] = [T] and [G] = [C]. These…
A: In a double-stranded stranded DNA, the amount of purine nucleotide is equivalent to the number of…
Q: The electrical current created during gel electrophoresis forces DNA to move from the negative end…
A: Answer. DNA or Deoxyribonucleic acid is made up of nucleotides. A nucleotide contains a phosphate…
Q: How does DNA differ from RNA with respect to the following characteristics? a) number of chains b)…
A: Single-celled organism to complex multicellular plants and animals make up the diversity of life on…
Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak…
A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…
Q: suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three…
A: Introduction: Those biomolecules that require in large amount to keep the body fit and healthy are…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: The introduction to this chapter, which describes the sequencing of 4000-year-old DNA, emphasizes…
A: The cell is a fundamental unit of life. Within its nucleus lies the genetic material which is the…
Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.
A: Replication is one of the essential properties of genetic material because the progeny cells should…
Q: What forces hold the two individual strands of DNA together to form a double helix? a. ionic bonds…
A: DNA is a type of nucleic acid. It is a polymer of nucleotides. A nucleotide is made up of sugar,…
Q: Compared to a 3% agarose gel, how far should the same size DNA travel in a 1% agarose gel? not as…
A: The DNA has a uniform mass proportion, DNA particles are isolated by size inside an agarose gel in…
Q: You analyse some DNA using an automated sequence reaction. The first peak you observe is labeled…
A: Given: You analyse some DNA using an automated seqyence reaction. The first peak you observe is…
Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”
A: Substitution is a type of genetic mutation in which there are three possibilities after the…
Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…
A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…
Q: What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very…
A: dna is the genetic material . it is formed via the polymerization of nucleotides . a dna molecule…
Q: Adenine and thymine are complementary base pairs. The two strands are anti-parallel. The base…
A: DNA are the molecule that carries genetic information in all living things.
Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel…
A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the…
Q: DNA Structure On the diagram: Label the 3' and 5' ends. G Circle a nucleotide Label the sugar and…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: How many times wider is a 30 nm fiber than a DNA double helix? Show your work.
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: What property/characteristics can definitely be concluded from the given composition of a DNA? A =…
A:
Q: Using your own words and including the phrases “5’ to 3’” and “3’ to 5’” explain how a double helix…
A: DNA or deoxyribonucleic acid is the genetic material of many organisms including humans. The two…
Q: A researcher combines a variety of molecules needed for DNA replication. After adding DNA to the…
A: The correct option is (A) DNA ligase
Q: Which of the following pairs do not match? O DNA has an antiparallel : direction with 5'-phosphate…
A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: The complementarity of its two strands is the underlying reason that DNA can be faithfully copied.…
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: Which is best explanation of "Law of Base Paring?" O determines the type of protein produced allows…
A: A base pair (bp) is a basic unit of double-stranded nucleic acids, consisting of two nucleobases…
Q: The sequence below is one strand from a double-stranded DNA molecule. How many hydrogen bonds hold…
A: In a double-helix, DNA is made up of two strands of nucleotide or nitrogenous bases which are…
Q: Like DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side…
A: Adenine bonded with thymine
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: The DNA double helix looks like a twisted ladder.What makes up each rung of the ladder?What holds…
A: DNA (Deoxyribonucleic acid) is the major macromolecule that is the key factor for transfer of genes…
Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…
A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…
Q: When DNA is heated sufficiently, the strands separate. The energy that it takes to separate the DNA…
A: Deoxyribonucleic Acid(DNA) is a double-helical structure. It has two strands that are joined by…
Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…
A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Q: Complementary strands in DNA double are defined by: a. jonic interactions O b. H bonds O c. С.…
A: DNA is double-stranded and has an anti-parallel helical structure. In DNA double helix two strands…
Q: Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one…
A: DNA sequencing is a technique used to study the nucleotides of DNA. It is used to determine the…
Step by step
Solved in 2 steps
- Which of these is not a tool for comparing DNA sequences?Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHMuch of the human genome consists of repetitious DNA. Describe the difference between microsatellite and minisatel lite DNA. How is this repetitious DNA useful for identifying individuals by the technique of DNA fingerprinting?
- Explain why phenol:chloroform is used in the isolation of genomic DNA (What is the end result and what must you do for the desired effect)Why do you suppose that forensic DNA analysis relies principally onshort tandem repeats (repeat polymorphisms) rather than single-nucleotidepolymorphisms?What would spread (fragmented) bands in the electrophoresis gel tell you about the quality of your DNA? Explain briefly, yet clearly
- During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?Which of these is not a tool for comparing DNA sequences? BLAST Fasta PLINK A dotplot e.g. dotletbased on the picture What is the length in basepairs of these sequences? How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)
- Which two species in this DNA sequence alignment are the most closely related? Explain your answer referring to specific nucleotide positions to justify the choice you made.Gel Electrophoresis Separates DNAFragments According to which thing?The gel pattern below was produced by the Sanger sequencing method. Determine the sequence (including 5' and 3' ends) of the double-stranded DNA fragment used to make this gel.