Answered: Given the choices, a. 26 b. 23 c. 27 d.…

Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: GCTGTGCACT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: Okazaki fragments are short DNA pieces that explain how

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Explain how an agarose gel can separate DNA fragments of different lengths.

A: Agarose gel electrophoresis is one of the important molecular techniques used for the separation of…

Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…

A: Since you have asked multiple questions with multiple parts, we will answer only the first three…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: In the Watson-Crick model of DNA structure: Question 5 options: T can form three hydrogen…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: Determine the characteristics of this piece of double-stranded DNA. GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA…

A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: The composition (in molefraction units) of one of the strands of a double-helical DNA molecule is…

A: Nucleic acids are an important type of biomolecules for all types of biological systems. They help…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: How will each of the following substances or conditions affect DNA structure? a. ethanol; b. heat;…

A: Deoxyribonucleic acid or DNA is a molecule composed of two polynucleotide chains that coil around…

Q: The introduction to this chapter, which describes the sequencing of 4000-year-old DNA, emphasizes…

A: The cell is a fundamental unit of life. Within its nucleus lies the genetic material which is the…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: What entropic factor destabilizes helical DNA at high temperature?

A: The double (ds) stranded DNA undergoes structural changes also known as denaturation at high…

Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…

A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…

Q: The composition (mole fraction) of one of the strands of a double-helical DNA is (A] = 0.3, and (G]…

A: Given; [A]=0.3 and [G]=0.24 We have to follow Chargaffs rule here; A+T=G+C A forms 2 H bonds with T…

Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…

A: According to Chargaff's rule, DNA of organisms should have 1:1 stoichiometric ratio of pyrimidine…

Q: A DNA sample contains 21% adenine. What is its completepercentage base composition?

A: DNA is the deoxyribonucleic acid which is a double-stranded helical structure found in the nucleus…

Q: QUESTION 21 Observation of purified DNA as "beads on a string" first indicated the presence of: а.…

A: DNA is considered as the genetic material, which helps to control all the functions of the cell. In…

Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…

A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…

Q: What are SMC proteins? Describe the function of SMC proteins and explain how they might contribute…

A: Chromosomes must be supercoiled or they would not fit inside the nucleus (5 micrometers) of human…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: 38 In order to amplify a gene by PCR, one needs to know the exact DNA sequence of the regions…

A: Introduction:- Polymerase chain reaction (PCR) is a widely used method for rapidly producing…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20

Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…

A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…

Q: The actions of the mismatch repair system become especially critical in regions of DNA that carry…

A: Mismatch repair system is a type of DNA repair system where it replaces correct nucleotides in the…

Q: pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA…

A: DNA (deoxyribonucleic acid), as well as RNA (ribonucleic acid) both, are the genetic material in the…

Q: Which of the following rows describes the difference between DNA and RNA?

A: DNA or deoxyribonucleic acid is the double stranded helical structure that is the genetic material…

Q: Rosalind Franklin (Early 1950s) A. What did she discover about the probable shape of DNA? B. What…

A: The experimental science that determines crystal atomic and molecular structure. This crystalline…

Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…

A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…

Q: 1. Define the relationship between twist, writhe and linking number. Are the twist and writhe…

A: Twist, with and Linking number are used to define the helical pattern and the orientation of dna…

Q: the difference between DNA and ARN

A: DNA and RNA are the genetic material in the living organisms. They contain and pass the information…

Q: DNA helicase

A: DNA helicases are defined as molecular motors. It disrupts the hydrogen bonds which hold together…

Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…

A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…

Q: Complementary strand for A T C and G

A: There are two types of nucleotide bases in DNA - Purines - A(Adenine) and G(Guanine) Pyrimidines -…

Q: 34. Give the sequence of the complementary DNA strand of the DNA chain with the following base…

A: Complementarity refers to the lock-and-key relationship between two structures. Complementarity is a…

Q: tate Chargaff’s rules. How did these rules help to discern the structure of DNA?

A: There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or RNA. Both…

Q: 46. 1 10 日 # Toko dedod Uesty A. Cri du chat syndrome B. chromosome 5p deletion syndrome C.5p minus…

A: Different chromosomal aberrations and gene mutations are responsible for producing different…

Q: Chargaff determined the base composition of DNA from a variety ofdifferent sources.What information…

A: Introduction DNA is the genetic material whose structural unit is nucleotides. Each nucleotide…

Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…

A: DNA replication is the process by which cell makes new copies of the DNA molecule.

Q: Can you recall the two chemical differences between DNA and RNA?

A: The material used to store genetic information in the mitochondria or nuclei of an organism’s cells…

Q: Why does increasing salt concentration increase the melting temperature of DNA?

A: DNA is a type of nucleic acid in which two antiparallel polynucleotides are coiled around a central…

Question

Given the choices,
a. 26
b. 23
c. 27
d. 21

how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: GCTGTGCACT

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
The backbone of the DNA molecule is made up of two alternating componebts, what are these? Explain.
In E. coli, the DNA helicase is loaded onto the DNA by __________ and activated when __________ binds the helicase. Question 24 options: DnaC; DnaG DnaA; DnaB DnaG; DnaC DnaB; DnaA DnaC; DnaB
31. Who discovered the shape of DNA and the genetic code it holds? To get full credit for this question, you must use evidence you have learned from this class. You must also defend your answer and why you think you are correct?
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
What are Okazaki fragments and how they are formed?
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
Describe the structure and complementary base pairing of DNA.
110.Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during the termination of replication in the lagging strand? A. DNA Ligase B.DNA Polymerase III C.RNA Primase D.DNA Topoisomerase