For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA? Group of answer choices a. UGUGCAAAGUUA b. AGACAATTCAAT c. TCTCGTTTGTTA d. TGTGCTTTCTTA

For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA? Group of answer choices a. UGUGCAAAGUUA b. AGACAATTCAAT c. TCTCGTTTGTTA d. TGTGCTTTCTTA

Name: For the following sequence of amino acids, serine-valine-lysine-leucin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA?Group of answer choicesa. UGUGCAAAGUUAb. AGACAATTCAATc. TCTCGTTTGTTAd. TGTGCTTTCTTA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 4QP: If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA...

See similar textbooks

Similar questions

State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
What is the complementary sequence of the given nucleic acid sequence? (Write your answer in the 5'-->3' direction) Given: ACTGGTCAGGCTTACGTAGTC
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'
Please choose the correct answer. Given the sense strand of DNA, A T G T A A C C G C G C A A G G G C A T G T G A, how many amino acids are in the protein coded by this piece of DNA? a. five b. six c. seven d. eight
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Which of the following amino acids is unique in that it can bind both non-specifically to the DNA backbone as well as to specific DNA bases? a) Lysine b) Asparagine c) Arginine d) Phenylalanine e) Leucine
Type the matching bases in each DNA sequence. G A T A G C T A G G