Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.
A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…
Q: What is the only known effect of deficiencies in complement components C5–C9? Explain this effect.
A: Introduction: The innate humoral immune system relies heavily on the complement system. The…
Q: 8. Where do the carbon atoms in pyruvic acid end up following the Krebs cycle? A They build up in…
A: Introduction In eukaryotes and prokaryotes, the citric acid cycle is the most common form of…
Q: Why monarch butterflies are supposedly toxic?
A: Due to its size and spectacular orange, black, and white pattern, the Monarch butterfly (Danaus…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: Q4.3. The DNA in a cell is intact and functional, but something in the cell's DNA replication…
A: The DNA is the genetic material in living cells. DNA replication is a process by which a…
Q: At which level of an energy pyramid would you expect to find the largest population of organisms? a…
A: Introduction Population pyramid reflects the age and gender of a specific population. It is a visual…
Q: Explain why the study of the human body can beoverwhelming
A: Introduction Humans are the most common and widely distributed primate species, with bipedalism and…
Q: One of the carbon atoms of a glucose molecule is [C14] - labeled. If 14CO₂ is released during the…
A: Glycolysis is the metabolic pathway that converts glucose, into pyruvic acid. The free energy…
Q: Consider a transmembrane protein that forms a hydrophilic pore across the plasma membrane of a…
A: Membranes are composed of a hydrophobic core of phospholipid tails.
Q: Use the following diagram to answers the questions. A. Is this cell Gram + or Gram -? Provide 2…
A: Bacteria are a broad collection of tiny, unicellular creatures that have been classed as prokaryotic…
Q: Which of the following is not a function of the kidneys? a elimination of urine b filtration of…
A: Kidneys are a pair of bean shaped organ. Kidneys help in removal of waste products from body.
Q: explain as precisely as you can but in no more than 100 words the ionic basis of an action potential…
A: Introduction :- An action potential (AP) occurs in physiology when the membrane potential of a…
Q: In the biological sense of the term (and not psychological!), why can't we say that individuals…
A: Introduction The statement individuals do not evolve, populations do is rooted in the (classical…
Q: Darwin and the Theory of Evolution - V2 So how and why did Charles Darwin come to develop his…
A: The theory of evolution is founded on the assumption that all species are connected and evolve over…
Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…
A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…
Q: Summarize the steps in generating an action potential as a flowchart. You can make your flowchart on…
A: Action potential occurs when the already negative potential inside the membrane becomes positive.…
Q: C Class: Common Name:_ ass: ammon Name:
A:
Q: What has caused the population illustrated below to slow down? a consumption of resources b high…
A: The growth of the population depends on several factors. The factors affecting the population growth…
Q: Please give me 1.the definition of vaccine and 2.advantages and disadvantages of vaccines
A: Introduction: After inoculating a 13-year-old child with vaccinia virus (cowpox) and demonstrating…
Q: Q13-A normal hematocrit is (40 -80) value * high 60 indicate
A: volume percentage of red blood cells (RBCs) in blood, as evaluated by a blood test, is known as the…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: Which structure is the male gametophyte? the microgametophyte the pollen grain O the megagametophyte…
A: Introduction : All plants and some algae species have a stage in their life cycle known as the…
Q: Name: - In humans, being a tounge roller (R) is dominant over non voller (r). A man who is a…
A: As per BNED rule only first question should be answered, so kindly submit the other question…
Q: Which of the following technologies can best differentiate between a diploid wild banana and a…
A: Edible banana have either 22 , 33 or 44 chromosomes that represent diploid , triploid and…
Q: S1 heart sounds (“lub”) represent the closing of the
A: Heart is the main pumping orgen of circulatory system and vital organ of body. Contraction and…
Q: Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain…
A:
Q: The role of health promotion in improving population health is vital, focusing on one of: smoking,…
A:
Q: 3. Please identify the stage of mitosis that is represented in the image and describe what is…
A: Mitosis is done in four stages - Prophase, Metaphase, Anaphase and Telophase.
Q: The amino acids of proteins can enter the process of cellular respiration, but first the must…
A: Introduction Cellular respiration is almost always aerobic but anaerobic can sometimes be relied…
Q: Query Sequence A 0 Database Sequence B 10 0 5 Match 1 30 35 38 25 40 30 33 Match 2 Mismatch Match 50
A: Sequence alignment refers to the arrangement of the DNA/RNA/protein sequences to find out the…
Q: Based on the results of Mendel’s experiments, what principle of heredity supports his findings on…
A: Introduction The transmission of qualities from parents to offspring is referred to as heredity.…
Q: Give a short comparison between alcohols and aldehydes as chemical antimicrobial agents.
A: Introduction Antimicrobial agents are widely used chemical substances or physical agents which can…
Q: Which of the patterns below is not an MII pattern? A в с D
A: In some fungi, product of meiosis is four spores or eight spores.
Q: Plant hormones______ . a. trigger the same responses in animals and plants b. are cues for tropisms…
A: Introduction Plant hormones are signal molecules produced by plants and present in extremely low…
Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…
A: Introduction A mutation is a change in the structure of a gene, which is the fundamental unit of…
Q: What is the central theme of molecular genetics? Now let's look at the entire process of taking DNA…
A: As per our guidelines you are not allowed to answer more than three sab parts at a time please ask…
Q: Q4.7. In DNA replication, what is the difference between the leading and lagging strands? In the…
A: Replication is the process by which double stranded DNA molecule is copied to produce two identical…
Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…
A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…
Q: What is wrong about calculating charge of a polypeptide based on the pKa of individual amino acids?…
A: The polypeptide chain is produced by the joining of amino acids together with the help of peptide…
Q: Give a short, concise discussion of lysogeny in viruses.
A: Introduction : A virus is made up of a core of genetic material, either DNA or RNA, that is…
Q: A21. Two single-base substitutions in the trpA gene of E.coli both affected amino acid number 234.…
A: Missense mutation defines the alteration of genetic code/codon via the single base pair…
Q: 21. The heart of Peter Mitchell’s theory of chemiosmosis implies that the connection between…
A: Oxygen is required for cellular respiration and the metabolism of dietary energy (oxidative…
Q: Why is this ligand for the NK-cell receptor CD94:NKG2A. considered a broad mechanism for the NK-cell…
A: NKT cells exhibit a wide range of receptors and kill the infected body cells and tumor cells.
Q: During the process of anaerobic cellular respiration, the final electron accepter in the electron…
A: Anaerobic respiration is the respiration process similar to aerobic respiration but it does not use…
Q: Ardipithecus Australopithecine S Homo habilis and Homo rudolfensis Homo ergaster and homo erectus…
A: Evolution:- The evolutionary process that led to the formation of Homo sapiens as a unique species…
Q: Pollen grains are derived from a microsporocyte, developed inside the microsporangia of an anthe and…
A: Flowering plants are known as angiosperms. The reproductive organ of angiosperms is the flower.…
Q: List Darwin's Postulates and show which ones are random and which ones are deterministic
A: Evolution Evolution is a continuous process involving change which occurs due to the adaption of new…
Q: on Which of the following statements about enzymes is CORRECT? Select one:* O A. Enzymes slow down…
A: introduction: Proteins are the most common, although some RNA molecules can function as enzymes.…
Q: You have cloned a novel E. coli gene and wish to express protein from it in human cells. In order to…
A: The Central Dogma theory explains that DNA forms DNA by Replication, DNA forms RNA by Transcription…
Why is vitamin K given to newborns upon delivery? What happens if the newborn does not get the injection?
Step by step
Solved in 2 steps
- Why is a regular diet schedule important for a 9 months old baby ?Seeing that the placenta acts as a barrier protecting the baby from harmful substances the mother may consume, how come some babies develop ailments like Fetal Alcohol Syndrome? Are there some substances that render the protective function of the placenta less useful than required?What causes the newborn to take its first breath immediately after birth?
- If you are a mother and your toddler is very sickly. What do you think is the reason why he/she is very sickly? What will you do?Why it is immoral to make headless babies for organ transplants?Why should women consider collecting and freezing oocytes for use later in life when they want to have children? What are the risks to the baby associated with older women having children?