With regard to RNA polymerase proofreading ability, which of the following is true? OA 3'5' exonuclease fixes all errors in mRNA. There are specialized mRNA repair pathways that remove noncomplementary nuclec No proofreading occurs. RNA backtracking can remove noncomplementary nucleotides. RNA and DNA polymerase proofreading are essentially identical. OOOOO

With regard to RNA polymerase proofreading ability, which of the following is true? OA 3'5' exonuclease fixes all errors in mRNA. There are specialized mRNA repair pathways that remove noncomplementary nuclec No proofreading occurs. RNA backtracking can remove noncomplementary nucleotides. RNA and DNA polymerase proofreading are essentially identical. OOOOO

Name: With regard to RNA polymerase proofreading ability, which of the foll
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: With regard to RNA polymerase proofreading ability, which of the following is true?A 3'5' exonuclease fixes all errors in mRNA.There are specialized mRNA repair pathways that remove noncomplementary nuclecNo proofreading occurs.RNA backtracking can

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
What are two advantages for circularizing the mRNA during the process of eukaryotic translation? (Select two correct answers) mRNA circularization ensures that translation terminates at the proper termination codons. mRNA circularization facilitates the binding of the ribosome to the Shine-Dalgarno sequence. mRNA circularization ensures that a full-length mRNA is used in the process of translation. mRNA circularization eliminates the requirement for translation factors in the process of translation initiation. mRNA circularization allows for a more efficient re-initiation of the translation process during repeated cycles of translation.
Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
Which of the following features is common to both DNA replication and RNA transcription? Both RNA and DNA polymerase form a sugar-phosphate bond between the 3' hydroxyl and the 5' phosphate. Both RNA and DNA polymerase require oligonucleotide priming. Both RNA and DNA polymerase incorporate deoxyribonucleotides into the growing sequence. Both RNA and DNA polymerase initiate at promoter sequences. Both RNA and DNA polymerase have extensive proofreading editing.
siRNAs and miRNAs are produced by: Group of answer choices The cutting and processing of double-stranded RNA by Slicer enzymes The cleavage if functional mRNA within cytoplasm The cleavage of RISCs by endonucleases The cleavage of pre-mRNA in the nucleus The cutting and processing of double-stranded RNA by Dicer enzymes
Which of the following statements regarding complementary molecules in transcription is false? Group of answer choices The sense strand is complementary to the template strand The transcribed RNA is complementary to the noncoding strand The coding strand is complementary to the antisense strand The transcribed RNA is complementary to the coding strand
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′