You design a pair of PCR primers to amplify the entire protein-coding region (start codon to stop codon of your favorite gene (FG), which encodes a protein consisting of 500 amino acids. When you amplity genomic DNA with this primer pair, you obtain a PCR product 2800 DNA bp long What is the combined number of base pairs in introns within the coding region? Express the answer as an integer Typed numeric answer will be automatically saved

You design a pair of PCR primers to amplify the entire protein-coding region (start codon to stop codon of your favorite gene (FG), which encodes a protein consisting of 500 amino acids. When you amplity genomic DNA with this primer pair, you obtain a PCR product 2800 DNA bp long What is the combined number of base pairs in introns within the coding region? Express the answer as an integer Typed numeric answer will be automatically saved

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 6P: Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki...

See similar textbooks

Similar questions

Question:- When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.
Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein
MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.
Question- There are 2x10-3 mutations in every replication of a given strain of bacteria, and this bacterium replicates once every 30 minutes. How many mutations are there in 5 hours, assuming carrying capacity of the environment is very large (i.e. the bacteria are still in exponential growth) and there is one bacterium at t=0? The answer is ________.
Question:- Many cancer treatment drugs specifically target DNA synthesis/replication. Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any specific types of cancers?) What specific DNA process does it target? From a molecular biology perspective (what you have learned so far), what are the negative outcomes of targeting this process?.
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
question- If you wanted to make a cDNA library , which of the following enzymes would you definitely NOT need? SELECT ALL THAT APPLY. RNA polymerase, Cas9, Restriction enzymes, DNA ligase, Reverse transcriptase, Phosphatase
Why are consensus sequences found in cis-elements typically only 5-6 bases long?Question 19 options: because 6 specific nucleotides is so unique that you would never find the same 6 nucleotides anywhere else in the genome. because they don't want to be too specific because it developed that way by random chance through evolution because only 5-6 bases are exposed to one side of the DNA helix because proteins are very small and can only span 5-6 bases
Question:- A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA was used for translation. What is the probability of producing the following amino acids? NOTE: Answer in fractions only. 1. Threonine _____ 2. Asparagine _____ 3. Histidine _____ 4. Lysine _____ 5. Proline _____
Question- You have a new microorganism that you have just isolated. You suspect your bacterium is capable of degrading cellulose. You know that these bacteria will have exoglucanases, endoglucanase, and β-glucosidases if they are able to degrade cellulose. 1. What DNA sequencing method would you use? 2. How would you predict the ORFs of the sequence you obtained? 3. How could you predict the functions of those proteins and its metabolic pathways? 4. What enzymes would you look for in the predicted functions of the ORF of the DNA sequence?
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG