You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASE enzyme that degrade MRNAS starting at their poly A tail is no longer functional. Choose the description that best describes the end result of this mutation. O a No MRNA can be degraded and resulting proteins will forever be made in the cell O b. There is no etfect on the cell O c. Gene A MRNA cannot be degraded and resulting Protein A will forever be made in the cell Od. Gene B MRNA cannot be degraded and resulting Protein B will forever be made in the cll
Q: The more dangerous type of translocation?
A: Translocation is the process of rearrangement of chromosomes in a out of phase and irregular manner ...
Q: Aneuploidy refers to the loss or gain a chromosome part. B. Polyploid cells have extra chromosome s...
A: Polyploidy is defined as the presence of more than two haploid sets of chromosomes in a species. It ...
Q: Help the label name
A: Thoracic vertebra(12 vertebrae (T1 to T12)) Vertebrae of the thoracic region have limited movement a...
Q: Please provide an illustration of the stages of meiosis of Ascaris lumbricoides: Anaphase I, Telopha...
A:
Q: What amino acid is coded by the original sequence (GTA) if the sequence refers to the template stran...
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to g...
Q: Smallpox and Plague continued to bedevil Europe and what appeared to be a new disease, Typhus, made...
A: The scientists who H. T. Ricketts and L. von Prowazek who were investigating typhus after they contr...
Q: Please answer fast why do some cells lose their alkaline phosphotase and others have more in the ki...
A: Alkaline phosphatase is a cell injury marker it signifies any pathology which changes the cellular a...
Q: Question 29 1) Listen People can make fermentation products as well as yeast. True False
A: People can make fermentation products as well as yeast.
Q: Explain why the seeds of fruit trees like durian, rambutan, and avocado could not be stored in the c...
A: Seeds are stored because of the prevention of seed dormancy. Dormant seeds are viable seeds that don...
Q: Researchers were working to determine the evolutionary history of modern horses using fossils of fou...
A: Introduction: Fossils are the traces of ancient life that have been preserved by natural processes, ...
Q: Please answer fast Short explanation needed. Elaborate/discuss the metabolic pathways by which cel...
A: Is mitochondria is the power house of the cell ATP is the currency ATP stands for adenosine tri pho...
Q: Use examples to describe some applications of phylogeny.
A: The study of the classification of living forms is known as systematics. Systematic biology is the s...
Q: Venous blood pressure is equal to 6-8 O 20 3-7 12/8
A: Introduction Venous Blood Pressure:- It is the average blood pressure within the venous compartment ...
Q: Which of the following is common among proteins with similar purification levels: Similar ________ ...
A: Purification of proteins allows for better specificity and better understanding of that protein func...
Q: 1. What natural defenses do you have against this infection? 2. What role does your adaptive imm...
A: * Natural defence and immune system defend the body against infections. *Natural barriers examples s...
Q: MRI After arousal to equilibrium, which relaxation time is longer, T1 or T2? They are independent p...
A:
Q: Members of the cactus family in North and South America and of the spurge family in Africa are very ...
A: Cactus belongs to Cactacese family. Euphorbias also called spurge belongs to Euphorbiacese family. ...
Q: A river reached a flood that was passing through it. At a given instant, the storage of water in the...
A: A branch of earth science that is related to the water in streams and lakes, rainfall and snowfall, ...
Q: In 1950, using “blender” experiment, Hershey and Chase demonstrated that DNA, not protein, is the ge...
A: Hershey and Chase came to the conclusion that the genetic substance was DNA rather than protein.
Q: If a women has 5 children, all of which are girl…what is the probability that the 6th child will als...
A: The sex of the off-spring depends on the male gamete that fuses with the female gamete. As males con...
Q: How do Fibonacci numbers exist in art and architecture, animal anatomy, and human anatomy?
A: Human anatomy is the study of the human body's structures. An understanding of anatomy is essential ...
Q: Identify the Genus of this organism.
A: Genus is Rhizopus.
Q: Please draw the diagram and explain. An organism with a diploid number of 6 reproduces sexually and ...
A: The term meiosis is associated with a form of cell division that results in the formation of four da...
Q: Scientists make use of several parameters in order to determine and analyze evolutiona relationships...
A: Evolution is the process through which the traits of a species change over numerous generations and ...
Q: A strawberry juice containing 5x10 bacteria cells/ml is pasteurized at 80°C for 30s. The average D-v...
A: Established industry practiceThere is an established practice among fruit juice manufacturers and bo...
Q: 14.22. Calculate the penetration depth of 100-MHz radiation in fat and in muscle.
A: Introduction: The tissue that stores fat in humans is called 'adipose tissue'. It is composed of spe...
Q: microscopes be classified according to the number of eyepieces
A: A microscope is an instrument that can be used to observe small objects, even cells. The image of an...
Q: Condition Isopods (type) Observed Number Expected Calculate d X^2 value Warm Roaches 2.8 1.936 Cold ...
A: For Roaches, the chi-square value is = 1.936. For df 1, P (0.05) = 3.841. Null Hypothesis - The null...
Q: if the membrane composition of the golgi in a cell is incorrect, what could have happened?
A: If the composition of membrane in Golgi body is incorrect then the cell is similar to the cell with ...
Q: Gregor Mendel (Father of Genetics) about his life and make an essay about his science experiments an...
A: About life:- Gregor Mendel, an Austrian monk, is widely regarded as the father of genetics. Many his...
Q: Color each part of the cell based on the color given on the other a ide Also, label each part of the...
A: Labelled structure is named below.
Q: QUESTION 1 Androgen insensitivity is caused by: A reduced ability to produce androgens A reduced abi...
A: Introduction :- Androgens are a category of hormones that predominantly affect the male reproductive...
Q: The advantages of Cryosurgery are There is little bleeding in the destroyed area The volume of tissu...
A: Cryosurgery: Cryotherapy is a treatment that involves your healthcare practitioner freezing and des...
Q: The HIV virus infects and destroys CD4 positive T cells, but otherwise mostly leaves the body intact...
A: Introduction: HIV is a sexually transmitted illness that affects both men and women (STI). It can al...
Q: Section one. Match enzyme or molecule with its function in bacteria. Answers may be used more than o...
A: Introduction DNA replication is the biological process of producing two identical replicas of DNA fr...
Q: How is inbreeding depression measured? With the fixation index Fst No answers are correct With the i...
A: ANSWER;-No answer is correct Explain;- In plants, inbreeding depression is ordinarily communicated a...
Q: The nucleotide composition of an organism's DNA can vary depending on its environment. How would you...
A: The DNA is made up of four nitrogenous bases. Different genes have different sequences and that is w...
Q: what practical importance are air borne microorganisms to the laboratory workers? What precautions...
A: Laboratories are the areas where lot of experiments and research is performed. It deals with lot of ...
Q: Identify the Genus of this organism.
A: Different parasites is responsible for causing different disease in human as well as in other animal...
Q: Attempt to seamlessly integrate the quotation into the text by using a signal phrase or structuring ...
A: Nutrients are the compounds found in food that give us energy, allowing us to heal and develop, whil...
Q: 8. In garden peas, round peas are dominant to wrinkled peas. If you crossed a homozygous dominant an...
A: Introduction: Dominant allele is able to express itself even in the presence of its recessive allele...
Q: The experiment of Erwin Chargaff proved that the number of adenines (A) and thymines (T) in DNA is t...
A: There are four nucleotide bases in DNA, namely- Adenine (A), Thymine(T), Cytosine (C) and Guanine (G...
Q: Match Column E with Column F. Column F may be used more than once or not at all. Column E Column F a...
A: Arterial Blood Gas Test: The amount of arterial gases, such as oxygen and carbon dioxide, is measur...
Q: If there are 9 chromosome pairs, what is the chromosome number at telophase I (after cytokinesis)?
A: * Meiosis is of two types Meiosis I Meiosis II * Meiosis I consists of four stages Prophase 1 M...
Q: Which of the following would occur? Select all that apply This mutant M-phase cyclin B will not be d...
A:
Q: What is chromatin made of? O DNA only O Carbohydrate only O Protein only O DNA and carbohydrate O DN...
A: Nucleus is basically considered as main controller of the cell. Each Nucleus inside the cell compri...
Q: In a cladogram, each node represents a(n)______ . a. single lineage c. common ancestor b. extinction...
A: Cladograms are diagrams which relate the relationships between different groups of taxa called clade...
Q: Saved Review the relationships between blood flow, flow velocity, total cross-sectional area, pressu...
A: Lesser than: Blood flow through the aorta is lesser than blood flow through the capillaries. Blood ...
Q: Aside from the ones already discussed about childbirth and blood pressure give another example of t...
A: The living organisms maintain homeostasis of there internal physiological conditions. This homeostas...
Q: Genetics on our daily lives, make an essay on how Genetics is affecting our lives by discussing at l...
A: INTRODUCTION Genetic is mainly study for the genes and hereditary activities and to ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- a. The reading frame DNA sequence is: b. The mRNA sequence is: c. The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
- If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately describes its consequence? A. There will be no mRNA or polypeptide made. B. The mRNA will be made but no polypeptide is made. C. The mRNA will not be processed properly. D. Nothing will happen. It is a silent mutation.A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
- In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells? Possible Answers: A. The mRNA will be spliced, but will not have a 5' cap. B. The mRNA will likely be degraded. C. The mRNA will not be cleaved. D. The mRNA will have too many Gs and Cs.