You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASE enzyme that degrade MRNAS starting at their poly A tail is no longer functional. Choose the description that best describes the end result of this mutation. O a No MRNA can be degraded and resulting proteins will forever be made in the cell O b. There is no etfect on the cell O c. Gene A MRNA cannot be degraded and resulting Protein A will forever be made in the cell Od. Gene B MRNA cannot be degraded and resulting Protein B will forever be made in the cll

You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASE enzyme that degrade MRNAS starting at their poly A tail is no longer functional. Choose the description that best describes the end result of this mutation. O a No MRNA can be degraded and resulting proteins will forever be made in the cell O b. There is no etfect on the cell O c. Gene A MRNA cannot be degraded and resulting Protein A will forever be made in the cell Od. Gene B MRNA cannot be degraded and resulting Protein B will forever be made in the cll

Name: You have 2 genes side by side on a chromosome, gene A and gene B. In
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASEenzyme that degrade MRNAS starting at their poly A tail is no longer functional. Choose thedescription that best describes the end result of this mutation.O a N

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

a. The reading frame DNA sequence is: b. The mRNA sequence is: c. The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately describes its consequence? A. There will be no mRNA or polypeptide made. B. The mRNA will be made but no polypeptide is made. C. The mRNA will not be processed properly. D. Nothing will happen. It is a silent mutation.
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells? Possible Answers: A. The mRNA will be spliced, but will not have a 5' cap. B. The mRNA will likely be degraded. C. The mRNA will not be cleaved. D. The mRNA will have too many Gs and Cs.