Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.
Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain
A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Write a sentence describing the role of each of the following types of RNA in gene expression.
A: mRNA - Messenger RNA (mRNA) is a single-stranded, complementary RNA molecule to one of the gene's…
Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…
A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…
Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…
A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…
A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…
Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…
A: The central dogma is referred as the central processing system which includes the transfer of…
Q: How do we know that mRNA exists and serves as an intermediate between information encoded in DNA and…
A: It was found that DNA did not directly produce proteins, but instead mRNA transcript is utilized…
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?
A: The sequence of a protein is usually notated as a string of letters, according to the order of the…
Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?
A: The proteins are the essential part of living organisms and it consists of thousands of smaller…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: Why do you think the DNA must be unzipped before it is transcribed into messenger RNA?
A: Gene expression is a complex biological mechanism that involves the production of mRNA and proteins…
Q: Each gene codes for just one protein.
A: The portion of the genome that codes for a protein or an RNA is referred to as a gene. The genes…
Q: What does the White gene code for?
A: Genes are the structural and functional units of heredity that carry coded genetic information in…
Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…
A: The central dogma of life states that there is a unidirectional flow of information from master copy…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein?
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: Define Universal code as they apply to the genetic code
A: Genetic code is universal. If AUG specifies methionine in monkey it also specify the same amino acid…
Q: In bacteria, single polycistronic MRNA encodes for:
A: This question is based on polycistron.
Q: Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript…
A: The sequence of three RNA or DNA nucleotides that corresponds to a particular amino acid or stop…
Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…
A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…
A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…
Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain.
A: mRNA brings information from the DNA for the formation of particular type of polypeptide. Therefore,…
Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…
A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…
Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: . What is meant by the phrase gene expression?
A: Gene - A gene is defined as a polynucleotide chain that consists of segments each controlling a…
Q: Discuss how the bigger mRNA leads to creation of a smaller polypeptide?
A: For protein synthesis, the first step in transcription. In transcription, the information from DNA…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: Introduction : The genetic code is the set of rules by which information encoded within genetic…
Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…
A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…
Q: why is it important that unprocessed mrna never leaves the nucleus?
A: Transcription is the process by which genetic information present in a DNA sequence is copied into…
Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…
A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…
Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…
A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…
Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?
A: Gene is a stretch of DNA that codes for a particular polypeptide chain.
Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…
A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…
A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…
A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…
Q: Is there any function for an intron?
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’Is the answer mRNA or Exon?
- What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGHow many amino acid are in each of the two polypeptides produced? And how many nucleotides long would the final processed mRNA made from the gene be?
- If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in? How many amino acids will the protein consist of?The genetic code is a complete, unabridged dictionaryequating the four-letter language of the _______?If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?
- What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.draw mRNA for this sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGIf the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY