Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2. AGAGAUUCAGCUAGCACGAUA 3. GUCAUCGAUCGAUCGGAUGCC 4. UUUCAGUCAGCUAGCGAUCGU 5. CUAAUGUGGAUCCUGAACGCU

Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence.  5' CAA…

A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA   (b) a tautomeric…

A: A codon is the three-nucleotide stretch of sequence which codes for proteins. In central dogma, it…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…

A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d.…

A: Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis.

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU

A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…

A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…

A: Following amino acid sequence is predicted.

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…

A: there are two types purines and pyramidines. A=T G=C In case  of mRNA  A=U Thymine is replaced by…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…

A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…

Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…

A: The synthesis of proteins with the help of  m RNA is know as translation.

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…