In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text

In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Amino acid spelling must match the spelling in the above table.
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"
Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU ala-met-stop ala-met-stop ala-met-phe phe-ala-met
Draw and label the different steps, including the DNA, RNA’s, the enzymes involved, in translation and transcription leading to the synthesis of the polypeptide: M-A-N-A-N-D-G-E-N-E
Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somatic
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids.mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
In each problem the DNA Triplet code is given. Determine the mRNA codon using base pairing and write the mRNA CODON into the blank. Using the mRNA CODON you identify in each problem and using the amino acid chart on the next page, identify the corresponding 3-letter amino acid (abbreviation) to place in each amino acid blank. 1. AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID2. TCG (DNA TRIPLET) = _______ (mRNA CODON) = _________AMINO ACID3. CTT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID 4. GGT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID
The following is the base sequence on the coding strand of a DNA molecule. AAT GCC AGT GGT TCG CAC Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

DNA	T-A-C	A-A-G	A-T-G	G-G-G	A-T-T
mRNA	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text	Enter Text — Enter Text — Enter Text
Amino acid	Enter Text	Enter Text	Enter Text	Enter Text	Enter Text