ED 361 W08 Midterm Lesson Plan Part 3
.docx
keyboard_arrow_up
School
Brigham Young University, Idaho *
*We aren’t endorsed by this school
Course
361
Subject
Biology
Date
May 24, 2024
Type
docx
Pages
7
Uploaded by UltraFogOwl42
W08 Project: Midterm Lesson Plan – Part 3
Instructions
1.
Complete each of the following components of the lesson plan in its assigned color
.
This section of the lesson plan is broken down below into two parts, Part 3A and Part 3B.
2.
To get an overview of your class and students, select the corresponding group in I-Learn according to your major:
Elementary Education Major student profiles
Secondary Education Major student profiles
Part 3A: Planning for Student Needs (This will be filled in based on the class descriptions and student profiles provided on I-Learn)
Reminder from the rubric: As you examine the needs of your students, seek to (a) demonstrate an awareness of special needs of students, (b) design accommodations decisions carefully planned with how to scaffold specific students’ needs, (c) use strategies to differentiate instruction to engage all learners in complex thinking, (d) employ multiple activities reinforce vocabulary growth for English Language Learners, and (e) organize instructional student groups in ways that maximize learning.
A. Use the description of the class/students provided on I-Learn to identify/describe any unique characteristics/needs of students in the class. Be sure to note any necessary class-wide needs
and pay specific attention to English Language Learners
as well as students with special needs.
What support strategies would you use with each student throughout the rest of the lesson (beyond those you have addressed in the assessment portion of the lesson plan)? For suggestions on student support strategies for individual learning needs during instruction/learning, refer to I-Learn. Based on the information provided by the instructor, my class starts in the morning following morning announcements and the students are often still sleepy and struggle to participate and respond to questions both in class discussion as well as working in groups. I have two students who are English Language Learners, Diego and Xiaowei. Diego’s first language is Spanish and even though he moved to the United States when he was 7, he often struggles with learning the material. He seems to be doing okay and many of his teachers don’t consider him to be as much of an ELL. Both of his parents can carry out a casual conversation in English and his mother can read, but his father cannot. Accommodations/supports for Diego for this or this lesson can be found in the chart below and in the timeline in Part 3B. Xiaowei's first language is Mandrin, and he moved to the United States when he was 4 years old. As a result, he was still in the process of learning Mandrin and then his parents focused on him learning English and only spoke to him in limited English. From this experience he is not proficient in English or Mandrin and struggles with his academics but has high expectations from his parents on his academic achievement. Accommodations/supports to
BYU-Idaho ED 361
help Xiaowei in this lesson can be found in the chart below and in the timeline in Part 3B. Matthew is a student in my class who has a learning disability that deals with processing and perceiving information into long term memory. It takes him a while to answer questions even if he knows the answers because of his disability. He struggles with fluid reasoning and numbers as well as reading and takes a significant amount more of time than his peers. Accommodations/supports to help
Kelvin in this lesson can be found in the chart below and in the timeline in Part 3B.
Student
Anticipated Struggle During
this Lesson
Accommodations/Supports
Diego
Falling asleep in class, writing and comprehending the material.
Making sure that I am checking up on him that he is staying awake. I will also add pictures to
help him connect English to the pictures. I will also have prewritten options with photographs that he will place and then explain to me why he placed them there and the meaning behind the sections they are placed in with the deeper level thinking task. Xiaowei
Struggles with short answers and the deeper level thinking task.
I will add pictures to help him connect English to the pictures and will give prewritten options with photographs that he will place and then explain to me why he placed them there and the meaning behind the sections they are placed in with the deeper level thinking task.
Matthew
Connecting ideas together and reading the materials. Allowing him extra time with time beforehand. He can also have a reader if he would prefer
to help him read and review the
questions as well as giving him prewritten options with photographs that he will place on the deeper level thinking assignment. Also included will be B. What do students already know/understand in relation to what will be taught? What misconceptions
are they likely to have in relation to the vocabulary, concepts, and/or topic? Reminder from the rubric: Be sure that (a) critical concepts are identified with their relationships to one another and (b) knowledge of prerequisite relationships from your lesson is evident.
BYU-Idaho ED 361
What Students Already Know/Understand: From the previous year they should have learned this content standard in 8
th
grade: MS-LS-1.3 Students who demonstrate understanding can: Make a claim supported by evidence for how a living organism is a system of interacting subsystems composed of groups of cells. This Year: Basesd on this year they will be going over the 9th Life Science objective/standard: HS-LS-1.2 Students
who demonstrate understanding can: Develop and use a model to illustrate the hierarchical organization of interacting systems that provide specific functions within multicellular organisms. Supporting Content LS1.A: Structure and Function • Multicellular organisms have a hierarchical structural organization, in which any one system is made up of numerous parts and is itself a component of the next level. (HS-LS-1.2) Misconceptions likely held by students regarding the vocabulary, concepts, skills, and topic: Students are likely to mistake the order of organism and confuse multicellular organisms from single cellular organism. They will likely misuse the terms hierarchal organization as well as interchange the words, molecule, organelle, cell, tissue, organ, organ system, and organism. Part 3B: Teaching/Learning Strategies; Instructional Timeline; Materials/Use of Technology:
In the table below, write out how you plan to use class time to engage students in learning. The procedures should clearly describe what students will do, what the teacher will do, and how long each lesson component is likely to take. Use the instruction models provided on I-Learn as suggestions for how you could structure time. In addition, be sure to address the introduction of the lesson, how student attention will be gained, how prior knowledge will be accessed, guided opportunities for students to practice and independent practice.
What students will do…
What teaching/learning strategies will be used by the teacher
and how they will be used to help facilitate learning… Be sure that (a) there is evidence of clear explanation of content that includes the relevance, context, and background needed for
specific lesson, (b) interdisciplinary connections are clearly established, communicated, and woven throughout the learning experience, (c) instructional strategies are outlined for teaching specific concepts, (d) learning activities are matched to instructional outcomes, (e) the lesson plan includes activities and questions for critical thinking, (f) students are required to engage in critical and/or creative and thinking and to produce original work, (g) the lesson or unit is well-
structured, with reasonable time allocations, and (h) closure involves all students actively in Materials and use of technology…
Detailed list/links to all materials, handouts, technology provided for
both teacher/students; in italics...clear explanation of how the technology used will help students to meet their learning goals.
Remember to include a variety of appropriately challenging, engaging materials and resources in the lesson that (a) extend beyond what is found at the school, (b) enhance student learning, (c) provide resources for differentiating needs of your students, and (d) include multi-disciplinary and digital tools that connect the content to local or global issues.
BYU-Idaho ED 361
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
Learning
Diagnostic Analytic
Recommendations
Skill plans
Math
Second grade > I.1 Identify living and nonliving things B5
1) Select the living thing.
STOP
stop sign
zebra
arrow_forward
Prior to starting this assignment red the accompanying articles below.
The Best Value in Formative Assessment
Formative and Summative Assessment - Yale Center
After reading the articles above answer the following questions then complete ethe activity below.
What is the difference between formative and summative assessment?
Why is it important to use formative assessment while teaching a lesson or during a unit or during a series of workshops?
What are some common whys to conduct formative assessment while you are teaching a lesson? How can you incorporate formative assessment into your lesson?
What are some common forms of summative assessment? List 4.
Why is it a mistake for a teacher to only use summative assessment?
Your job is to create a summative assessment for the following program and objectives.
You work for the NYC Department of Health and Mental Hygiene. You will be working on a 5-lesson presentation to 8th grade students during their health class in the middle…
arrow_forward
Instruction: Watch this 2 part lecture-video conducted by the Duke University on an introduction for Health Management Information Systems and answer the following questions below.
https://youtu.be/jd29oxyGKcE & https://youtu.be/UxMsMV2iLbI
Guide Questions/statement:
1. According to the lecture-discussion, what are the general characteristics of an Information System?
2. Describe what is a Health Care Information System.
3. According to the presentation, what are the advantages and disadvantages of utilizing the internet as a platform for healthcare applications?
arrow_forward
Assignment 2- Research and outline the Scope of
Practice for Medical Assistants in your state. (Google the
state board of medical examiners.)
arrow_forward
Topic: 2.1 Discussion Forum
+
https://ftccollege.instructure.com/courses/20120/discussion topics/272565?module_item_id=1000471
2024 04C April (4/1/2024)
me
abus
mouncements
This is a graded discussion: 100 points possible
2.1 Discussion Forum
BA✩
due Apr 9
34 34
dules
ades
ople
BlueButton
ar Deck Tutoring
The Medical Receptionist
Instructions
The role of the medical receptionist includes knowing and understanding a wide variety of laws and regulations, answering an
almost constantly ringing telephone, reviewing insurance cards, determining insurance types or managed care plans, entering
demographic data into the computer, posting a variety of transactions, scheduling appointments, and professionalism. In other
words, the receptionist at a medical office should be a professionally trained medical assistant who is flexible and prepared for a
variety of duties.
. What are at least three important skills that you should have when working at a medical front desk? Explain why you think these…
arrow_forward
1.6 Assignment
- с
Login to Student Po.....
Pa
N
ccount
ashboard
Courses
Calendar
Inbox
History
21
Help &
FI
2
@
ftccollege.instructure.com/courses/18672/assignments/455374
S
the textbook:
Dr. Winston Lewis's patient, Annette Samuels, has come into the Inner City Health Care clinic complaining of lower
abdominal cramps and diarrhea. After discussion of her symptoms and a brief examination, Dr. Lewis's clinical diagnosis is
an intestinal parasite infection. She asks Gwen Carr, CMA (AAMA), to obtain a stool sample from the patient. The sample
will be sent to an outside independent lab to see if the parasite or its eggs can be visualized. This is called an ova and
parasite test or O&P.
Email | Microsoft 365
Type here to search
Gwen is sensitive to Ms. Samuels's level of understanding as she gives her specific instructions on how to obtain the
needed sample. She asks Ms. Samuels if she has questions, and she has Annette repeat the instructions to be sure she
understands them. When Ms.…
arrow_forward
n.instructure.com/courses/151/assignments/250
0 > Assignments
Reflective Journal
✓ Details
The student will be required to complete the following:
i. Self-Evaluation
ii. Remediation &/or Improvement Plan
h. References
Reflective Journal
Q Search
X
arrow_forward
(37 unread) ifeomamaduadi X
Topic VIRTUAL CLINICALS RE X Math Retresher
O A https://learn.swiftriveronline.com/VC/MathRefresher/4226525
MATH REFRESHER
SCORE: 50
6%
The client had the following for breakfast:
• 8 ounces of bran flakes with half-cup milk
• 8 ounces of coffee with 1 ounce creamer
• 8 ounces of liquid meal supplerment (i.e. Ensure®)
What is the client's total intake?
Enter your answer:
ml
Submit Answet
er
site
obat
er DC
W
14 O
13
f2
arrow_forward
ing Syst X
ps://student.atitesting.com/LTI
ati.
Browse Question
Dashboard Quiz ✓ Performance ✓
Learning System 3.0 NCLEX-PN 06-10-2022
4 of 20 questions
Highlight
Strikeout
Calculator
Note
Mark
A nurse is caring for a client who has heart failure and is prescribed dobutamine hydrochloride by continuous IV
infusion. The nurse should identify that which of the following is the therapeutic effect of this medication?
A. Improves oxygen saturation rate
B. Decreases elevated blood pressure
C. Reduces heart rate
OD. Improves cardiac output
Next
Pause
Previous 1
00
earch
Grade
Tutorial: Learning System PN 3.0
Module: Quizzes & Assignments
Et
H
DELL
arrow_forward
Defense Mechanism Worksheet
Student Name:
Class Period:
Using the descriptions on the back of this worksheet, determine which defense mechanism best
fits the examples given here. It is helpful to work in small groups and discuss the examples and
come to a group consensus.
1. Jim bought a sweater he really didn't need and couldn't
afford. He claimed it was a bargain he couldn't pass up.
2. I got a dean referral because the teacher doesn't like me.
3. Whenever there is something unpleasant to do, Mary gets
sick.
4. Tom is not strong academically, so he puts extra effort into
sports.
5. Bill seems unable to recognize any of his faults
6. Mister Smith had an argument with his boss. When he got
home he beat his wife.
7. Dan pouts and sulks when he doesn't get his way.
8. Whenever things go badly at work, Mr. Jones stops at the
park to play with the children.
9. Bob blames the bat every time he strikes out.
10. Mary has an overly strong urge to help people. This
influenced her becoming a…
arrow_forward
Course Home
My Courses
Course Home
Syllabus
Scores
Pearson eText
Document Sharing
User Settings
Course Tools
76°F
Mostly sunny
>
X Qbartebly - Search
b Success Confirmation of Question X +
https://openvellum.ecollege.com/course.html?courseld=17044720&OpenVellumHMAC=02ab23286d132bee2c1ff7fb0c33c5f5#10001
A
5:37 PM
5/31/2022
X
arrow_forward
(THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! (I am using this for study material.)
arrow_forward
logy
9 Grades | Schoology
9 Schoology
i bcps.schoology.com/common-assessment-delivery/start/4564693659?action=onresume&submissionld=354397431
Downloading SIM..
M Gmail
D YouTube
pt Maps
S Watch Disney Chan..
1/14 Show What You KnoW
2 of
POSSIBLE POINTS: 3.33
The reaction in the Candy Shop video shows the reaction between sugar and sulfuric acid. This reaction
v an example of a chemical reaction.
1
前Review
O
19 0
10
1123
12 O13O
15
fo 30
17 C0
(e
arrow_forward
Assignment WEEK 2 From the textbook Student PowerPoint Presentation: Chapter 9 to 16 Objectives: The presentation assignment has several goals. It requires students to apply concepts from Marketing, Dealing with demanding patients and creating office videos in Healthcare Institutions. The process of create a video will allow students to practice close the advantages, potential subject of the video for the office and choosing specific topics to take the opportunity to educate, a skill they will be using as Healthcare Administrator. In addition, presenters learn as they teach others and contribute multiple critical perspectives to class discussion. Format and Guidelines: The student will create a Power Point Presentation from Chapter 9 to 16 of the Textbook and the Article related to Week 2 (Choose your desire topic form these chapters). The Presentation should have a minimum of 12 slides, including Title Page, Introduction, Conclusion, and References. The student must use other…
arrow_forward
INSTRUCTIONS
• 3-5 Sentences ONLY!
• Do not Copy from Google
• Answer Properly
- Failed to follow instruction will directly report in Bartleby. Thankyou.
arrow_forward
Assessment
Topic:- Discuss the role of the nurse in acute care using peer-reviewed literature to support your points.(1400 words)
Instructions
To write an appropriate introduction to the topic
To critically read all six articles when reading to identify the critical points of each article.
Remember to back up your discussion with NMBA codes and standards for practice;
Use the synthesis matrix to assist in combining and developing these key points identified from the critical read of the article into themes
To write an appropriate conclusion to the topic
To provide In-text and end text reference of the article discussed in your essay using correct APA 7 formatting.
arrow_forward
Student Po...
ard
ses
STOR
andar
6
box
D
listory
?
Help &
A
2
N
F1
Email | Microsoft 365
1.1 Discussion Forum
Instructions
Professional Communication
Please, review chapters 12 and 15 of your textbook and respond to the following premises for your initial contribution:
1. In your own words, describe the proper procedures when working at the front desk of a medical office.
2. Explain the different types of scheduled appointments.
3. How important is front office organization for medical practice?
Note: Please read the instructions provided in the following links before submitting your entry:
Participation Rules
Online Etiquette Rules
Technical Instructions
•
2
Q Search entries or author
Type here to search
4 F2
Reply
W
S
Allt
x
A+
Log In to Canvas Cengage eTextbook
Cengage
3
F3
E
D
X
E P
F4
$
C
4
Unread
R
U
F
F5
eTextbook NCCT
6 dº
%
5
T
F6
(C
6
G
F7
&
V B
7
河
YU
H
F8
P
* CO
N
8
J
F9
019
F10
9
76°F Heavy rain
K
M
*-
O
F11
*+
L
V
F12
P
arrow_forward
UNIT
4
NURSING THEORIES
COURSE OUTCOME:
Utilizing relevant theories in the nursing practice.
Learning Objectives:
By the end of the lesson, you will be able to:
1. Create Major Assumptions for my Theory.
Activity 4: Theory Development: Major Assumptions
Instruction: After developing your introduction, write your major assumptions. These are state-
ments that you believe or hold as truth. It comprises your belief and values of your theory or con-
cept. You can use/add a different page if you think the space provided is not enough.
arrow_forward
During Intensive 2, Practical A, you will be assessing and implementing care for two patients (Louca & Sue) experiencing complications of diabetes. You will be randomly allocated one of these patients and you will need to complete a CRC Nursing Care Plan.
Click on the Groups tab to find out which scenario you have randomly been assigned. The care plan is based on the information that is provided on MyLO only (Sue- page 2.5 on MyLO; Louca- page 2.7 on MyLO), not on the additional cues that you obtain in the Practical session.
Case Study: 69-year-old Louca
Louca is a 69-year-old man who has had Type 2 diabetes for 15 years. He also has hypertension. He is a retired librarian who lives with his wife and dog. He has been overweight for most of his life and is currently classified as obese with a BMI of 38. His father was a Type 2 diabetic and died from a stroke at the age of 70.
To manage his diabetes, Louca’s GP has referred him to a Diabetes Education Centre to help manage his…
arrow_forward
Chrome
File
Edit
View
History
Bookmarks
People
Tab
Window
Help
School District of Palm Beach X
P Performance Matters | OLA
A Biology I Honors Miss Schwart X
N Netflix
A olapalmbeach.performancematters.com/ola/ola.jsp?clientCode=flPalmBeach#
P
Performance Matters
Welcome, Oriana Barradas!
Connection Status: Good
All changet
(? Submit
Question 9 of 12- O
Bio_U07_USA_FY21
Question: 1-9
In a biology lab, students view a droplet of pond water under a microscope. One student observes a green, one-celled organism that has a flagella. What can the student infer from these observations?
The organism must be photosynthetic since it is green.
The organism must be able to move since it has a flagella.
The organism must be a decomposer since it is single-celled.
The organism must be from the animal kingdom since it has a flagella.
arrow_forward
Identify three instructional changes you would make to the lesson plan (attached) to strengthen any of the following four aspects:
a. effectiveness of the instructional plan, including the following:
• anticipatory set
• presentation procedures for new information or modeling (or both)
• guided practice
• independent student practice
• culminating or closing procedure or activity
b. differentiation for multiple abilities or interests
c. alignment to each of the standard(s) of the lesson
d. promotion of healthy lifestyles or attitudes (i.e., Does the lesson effectively promote healthy lifestyles or positive attitudes toward health? How?)
arrow_forward
Books Required Holistic Nursing, A Handbook for Practice, 6th Edition Author: Dossey Montgomery, B., Keegan, L. ISBN: 978-1-4496-45632 Publisher: Jones & Bartlett Learning, (2013)
Week 3 6/26/17 – 7/2/17 Chapters to Read Week 3 Chapter 14: pg. 294- 303 Exercise and Movement Chapter 15: pg. 308 -318 Humor, Laughter, and Play Chapter 16: pg. 329 – 337 Exhibit 16-1; 16-2; 16-3 Chapter 18: pg. 400 – 408 Effectiveness of Music Delivered by a Health Provider Chapter 19: pg.418 – 429 Touch and Hand-Mediated Therapies 1. Discussion Question: Discuss the benefits of exercise and movement both in illness and in health. Discussion cannot be more than (300) words
arrow_forward
2. Many health issues have been discussed throughout the semester. Identify a lifestyle
choice that you could make and explain the short and long-term benefits you might
experience. Be sure to connect these benefits to course material to explain why these
benefits might occur
Lifestyle change:
a. Short-term benefits
b. Long-term benefits
arrow_forward
Good Morning Dear Students:
For your asynchronous class today November 12, 2021
Please read on the concepts of Health
Promotion and Wellness for the Older
Person and answer the following:
1. How
could we help older people adapt: process of aging?
2. What is the Aim of health promotion
3. Describe the following concept of Health and wellness in an older person on the following:
a. Physical Fitness (}Fitness Problems, Obesity, Healthy Choices, Physical Activity)
Factors Affecting Physical activity of Older People:
-Health Benefits of Exercise
Benefits of Strength training
b. Nutrition
Factorsthat Affect Nutrition of the Older Person: (physiologic/ Psychosocial factors)
c. Sleep
d Stress
4. We will discuss these topics in our synchronous class
arrow_forward
II
Log In x b My Que X
d.cuny.edu/webapps/assessment/take/take.jsp?course_assessment_id%3 2077934_ 1&course_id%3 2021853 18content id 62810464 18
Remaining Time: 1 hour, 31 minutes, 54 seconds.
* Question Completion Status:
Moving to the next question prevents changes to this answer.
Question 2
AAGTCAAGAAGAAGAAGAAGCC
A. The nucleotide sequence above is a STR of how many repeats?
B. What sequence is being repeated?
For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac),
TTTArial
3 (12pt)
E: - L ^
The nucleotide sequence5 above is 5
The sequence being repeated is AAG
I
41°F
e here to search
arrow_forward
Your Question:
PROJECT - MENTAL HEALTH
PSYCIATRIC AID
4. Laws and ethics that govern mental health technicians, psychiatric nurse AID, and patient care assistant.
arrow_forward
Medical Assisting Practicum:
Critical Thinking Case Study- Patient Care
Directions: Review the information provided in the case and use it as a Medical Assistant to answer the questions below.
Adelaide Robinson, 83 years old, has an appointment Thursday morning for a recheck of a wound she sustained after a trip and fall on her morning walk. While at the appointment, she tells you that she is moving slower than she did just six months ago, and she has noticed less flexibility as well. It has been very frustrating to her since she is very active and often babysits for her Great Grandchildren.
1. What are the possible causes of Mrs. Robinson's complaints?2. What effect will these problems have on Mrs. Robinson's daily routine?
3. What might the physician suggest Mrs. Robinson do to help alleviate symptoms? What would your role as a Medical Assistant be to in Mrs. Robinson's continuing care?
arrow_forward
Assessment 2: scenario based assessment
Instructions
This is a ‘scenario problem’. Read the information and answer the questions. Your answers must be concise, focus on the question (an introduction isn’t needed), and include a short explanation. ANSWERS OF ESSAY LENGTH ARE NOT REQUIRED. You will need to include some explanation as part of your answers. References should be included both in text (Harvard referencing system) and as a reference list at the end..
Please note that these questions are not equally weighted, and it is likely that answers to some will be a bit longer than others. Because of this, your mark will be based on your overall response to all of the questions. This doesn’t mean you can ignore a question – you must attempt all questions.
Consider the following scenario:
A group of five treasure hunters have been hired to retrieve some artefacts believed to be in an abandoned castle in an environment similar to the Arctic tundra (this is a quasi-fantasy land where…
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage
Related Questions
- Learning Diagnostic Analytic Recommendations Skill plans Math Second grade > I.1 Identify living and nonliving things B5 1) Select the living thing. STOP stop sign zebraarrow_forwardPrior to starting this assignment red the accompanying articles below. The Best Value in Formative Assessment Formative and Summative Assessment - Yale Center After reading the articles above answer the following questions then complete ethe activity below. What is the difference between formative and summative assessment? Why is it important to use formative assessment while teaching a lesson or during a unit or during a series of workshops? What are some common whys to conduct formative assessment while you are teaching a lesson? How can you incorporate formative assessment into your lesson? What are some common forms of summative assessment? List 4. Why is it a mistake for a teacher to only use summative assessment? Your job is to create a summative assessment for the following program and objectives. You work for the NYC Department of Health and Mental Hygiene. You will be working on a 5-lesson presentation to 8th grade students during their health class in the middle…arrow_forwardInstruction: Watch this 2 part lecture-video conducted by the Duke University on an introduction for Health Management Information Systems and answer the following questions below. https://youtu.be/jd29oxyGKcE & https://youtu.be/UxMsMV2iLbI Guide Questions/statement: 1. According to the lecture-discussion, what are the general characteristics of an Information System? 2. Describe what is a Health Care Information System. 3. According to the presentation, what are the advantages and disadvantages of utilizing the internet as a platform for healthcare applications?arrow_forward
- Assignment 2- Research and outline the Scope of Practice for Medical Assistants in your state. (Google the state board of medical examiners.)arrow_forwardTopic: 2.1 Discussion Forum + https://ftccollege.instructure.com/courses/20120/discussion topics/272565?module_item_id=1000471 2024 04C April (4/1/2024) me abus mouncements This is a graded discussion: 100 points possible 2.1 Discussion Forum BA✩ due Apr 9 34 34 dules ades ople BlueButton ar Deck Tutoring The Medical Receptionist Instructions The role of the medical receptionist includes knowing and understanding a wide variety of laws and regulations, answering an almost constantly ringing telephone, reviewing insurance cards, determining insurance types or managed care plans, entering demographic data into the computer, posting a variety of transactions, scheduling appointments, and professionalism. In other words, the receptionist at a medical office should be a professionally trained medical assistant who is flexible and prepared for a variety of duties. . What are at least three important skills that you should have when working at a medical front desk? Explain why you think these…arrow_forward1.6 Assignment - с Login to Student Po..... Pa N ccount ashboard Courses Calendar Inbox History 21 Help & FI 2 @ ftccollege.instructure.com/courses/18672/assignments/455374 S the textbook: Dr. Winston Lewis's patient, Annette Samuels, has come into the Inner City Health Care clinic complaining of lower abdominal cramps and diarrhea. After discussion of her symptoms and a brief examination, Dr. Lewis's clinical diagnosis is an intestinal parasite infection. She asks Gwen Carr, CMA (AAMA), to obtain a stool sample from the patient. The sample will be sent to an outside independent lab to see if the parasite or its eggs can be visualized. This is called an ova and parasite test or O&P. Email | Microsoft 365 Type here to search Gwen is sensitive to Ms. Samuels's level of understanding as she gives her specific instructions on how to obtain the needed sample. She asks Ms. Samuels if she has questions, and she has Annette repeat the instructions to be sure she understands them. When Ms.…arrow_forward
- n.instructure.com/courses/151/assignments/250 0 > Assignments Reflective Journal ✓ Details The student will be required to complete the following: i. Self-Evaluation ii. Remediation &/or Improvement Plan h. References Reflective Journal Q Search Xarrow_forward(37 unread) ifeomamaduadi X Topic VIRTUAL CLINICALS RE X Math Retresher O A https://learn.swiftriveronline.com/VC/MathRefresher/4226525 MATH REFRESHER SCORE: 50 6% The client had the following for breakfast: • 8 ounces of bran flakes with half-cup milk • 8 ounces of coffee with 1 ounce creamer • 8 ounces of liquid meal supplerment (i.e. Ensure®) What is the client's total intake? Enter your answer: ml Submit Answet er site obat er DC W 14 O 13 f2arrow_forwarding Syst X ps://student.atitesting.com/LTI ati. Browse Question Dashboard Quiz ✓ Performance ✓ Learning System 3.0 NCLEX-PN 06-10-2022 4 of 20 questions Highlight Strikeout Calculator Note Mark A nurse is caring for a client who has heart failure and is prescribed dobutamine hydrochloride by continuous IV infusion. The nurse should identify that which of the following is the therapeutic effect of this medication? A. Improves oxygen saturation rate B. Decreases elevated blood pressure C. Reduces heart rate OD. Improves cardiac output Next Pause Previous 1 00 earch Grade Tutorial: Learning System PN 3.0 Module: Quizzes & Assignments Et H DELLarrow_forward
- Defense Mechanism Worksheet Student Name: Class Period: Using the descriptions on the back of this worksheet, determine which defense mechanism best fits the examples given here. It is helpful to work in small groups and discuss the examples and come to a group consensus. 1. Jim bought a sweater he really didn't need and couldn't afford. He claimed it was a bargain he couldn't pass up. 2. I got a dean referral because the teacher doesn't like me. 3. Whenever there is something unpleasant to do, Mary gets sick. 4. Tom is not strong academically, so he puts extra effort into sports. 5. Bill seems unable to recognize any of his faults 6. Mister Smith had an argument with his boss. When he got home he beat his wife. 7. Dan pouts and sulks when he doesn't get his way. 8. Whenever things go badly at work, Mr. Jones stops at the park to play with the children. 9. Bob blames the bat every time he strikes out. 10. Mary has an overly strong urge to help people. This influenced her becoming a…arrow_forwardCourse Home My Courses Course Home Syllabus Scores Pearson eText Document Sharing User Settings Course Tools 76°F Mostly sunny > X Qbartebly - Search b Success Confirmation of Question X + https://openvellum.ecollege.com/course.html?courseld=17044720&OpenVellumHMAC=02ab23286d132bee2c1ff7fb0c33c5f5#10001 A 5:37 PM 5/31/2022 Xarrow_forward(THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! (I am using this for study material.)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:Cengage
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage