Quiz-Nov

#include using namespace std; void myfunction(int num2, int num1); lint main() { my function (5,2); return 0; } void myfunction(int num1, int num2) {if (num1>3) cout << "A1"; else if (num1<3) cout<<"A2"; else cout<<"A3";} O A2 O A1 O A3 A1 A2 A3

Q. You are asked to write a C program by storing student’s roll no., name along with their marks of six subjects for which you created a structure of ‘n’ students asfollows:struct student{int rollno;char name[25];int sub-marks[6];}s[n]; Do the followings on the above structure.i) Display all the student details by passing the structure to a function.ii) Find the total mark obtained by each student in all the six subjects.iii) Find the total in each subject obtained by all the students.iv) Print the details of the student who got the highest and who got the lowest marks assuming that there is one student who got the highest mark and one student who got the lowest mark.

This is the C code I have so far  #include <stdio.h> #include <stdlib.h> struct employees {     char name[20];     int ssn[9];     int yearBorn, salary; };   // function to read the employee data from the user void readEmployee(struct employees *emp) {     printf("Enter name: ");     gets(emp->name);     printf("Enter ssn: ");     for (int i = 0; i < 9; i++)         scanf("%d", &emp->ssn[i]);     printf("Enter birth year: ");     scanf("%d", &emp->yearBorn);     printf("Enter salary: ");     scanf("%d", &emp->salary); }   // function to create a pointer of employee type struct employees *createEmployee() {     // creating the pointer     struct employees *emp = malloc(sizeof(struct employees));     // function to read the data     readEmployee(emp);     // returning the data     return emp; }   // function to print the employee data to console void display(struct employees *e) {     printf("%s", e->name);     printf("  %d%d%d-%d%d-%d%d%d%d",…

C++ Functions provide a means to modularize applications Write a function called "Calculate"  takes two double arguments  returns a double result   For example, the following is a function that takes a single "double" argument and returns a "double" result double squareArea(double side){   double lArea;   lArea = side * side;   return lArea;}

C++ program Write a function named "reduce" that takes two positive integer arguments (as reference), call them "num" and "denom", treats them as the numerator and denominator of a fraction, and reduces the fraction.The function should return the value 0 (to indicate failure to reduce: if either of the two arguments is zero) and should return the value 1 otherwise.Function Prototype: bool reduce(int & num,int & denom);

C++ Language

C++ Plz solve as you can quickly

Assume the Product structure is declared in c++ as follows:struct Product{string description; // Product descriptionint partNum; // Part numberdouble cost; // Product cost}; Now write a loop that will step through the entire array array of 100 Product structures (do not initialize the array), setting all the product descriptions to an empty string, all part numbers to zero, and all costs to zero. ( Drop the screenshot of output as well )

C PROGRAMMING: FUNCTION

5. A function can return a value of an enumeration type.   True False

Question #1 Study the following C program and answer the below questions Hint: you might run it in Dev C++ before starting answering the questions! #include int main(void) { int number; char choice; printf("Please enter an integer number: " ) ; scanf("%d" , &number); printf("\nTo check whether the number is even or odd, press e \n"); printf("To check whether the number is positive or negative, press p \n"); printf("To check whether the number is multiple of 10, press m \n"); printf("\nPlease enter your choice: "); scanf(" %c" , &choice); switch(choice) { case 'e': case 'E': if (number % 2 == 0){ printf("\n%d is even \n" , number); else { printf("\n%d is odd \n" , number); } break; case 'p': case 'P': if (number > 0){ printf("\n%d is positive \n" , number); else if (number < 0){ printf("\n%d is negative \n" , number); else { printf("\n%d is zero! \n" , number); break; case 'm': case 'M': if (number % 10 == 0){ printf("\n%d is a multiple of 10 ' , number); } else { printf("\n%d is NOT a…

C++

Question #1 Study the following C program and answer the below questions Hint: you might run it in Dev C++ before starting answering the questions! #include int main(void){ int number; char choice; printf("Please enter an integer number: "); scanf("%d" , &number); printf"\nTo check whether the number is even or odd, press e \n"); printf"To check whether the number is positive or negative, press p n"): printf("To check whether the number is multiple of 10, press m \n"); printf("\nPlease enter your choice: "): scanf(" %c" , &choice); switch(choice) { case 'e': case 'E': if (number % 2 -- 0){ printf"n%d is even \n", number); else { printf"\n%d is odd \n", number); break; case 'p': case 'P': if (number > 0){ printf"\n%d is positive \n", number): else if (number <0){ printf("n%d is negative \n" , number); else { printf"n%d is zero! n", number); break; case 'm': case 'M': if (number % 10 -- 0){ printf"\n%d is a multiple of 10 \n" , number); else { printf("n%d is NOT a multiple of 10 n" ,…

C++ Programming

C++, functions and arrays (please don't use hard or high level code)

C++ Code: DNA Sequence  The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…

pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.

language = python

[c++] struct patient_data{      string name;    string no_id_card;    int hand_set_number;    string address; }; figure 1 By referring to the struct definition in Figure A, you are required to do a STRUCT declaration of MPI clinic patients and write a complete program in C++ in order to input data and display the output for 50 patients of MPI clinic

write code c++ creat struct names student Suppose the students' names 1. Lara 2. Rashed 3. sara Suppose any degrees u want #declare in the struct   matrix[3][3] #definition three function  one function Receive the quiz mark in the first column  the second function receive the mid mark in the second column  the third function receive the final mark in third column  # print the marks by using main function

c code Screenshot and output is must

Use C++ don't change the main function just complete the deleteRepeats function