. Using the structure of d-TMP show all the tructural fragments donated by different organic ompounds during d-TMP synthesis (in the tructure each fragment must be shown using rrow directed from the donor's name).

Q: What is the structure of the lipid?

A: Biological macromolecules are the molecules that are required in enough amount for the body.  It…

Q: In another experiment using Quikchange to amplify the pQE.1-CRYGD plasmid containing our mutation,…

A: Introduction A common laboratory method for producing several copies of a specific DNA region is the…

Q: Sudupe

A: Chromosomes are the condensed form of nucleic acid. The chromosomes are formed during the cell…

Q: Which of the following statements about cellular membranes is true? Transmembrane proteins are…

A: Introduction  All cells have a cell membrane, also known as a plasma membrane, which separates the…

Q: Based on the ORGANIZATION of neurons, why are some areas of skin more sensitive than others

A: Neurons are the basic structural and  functional unit of nervous system. These are capable of…

Q: Which statistical calculation would be used to study the range of variation that is present in a set…

A: Introduction :  The study of gathering, analysis, interpretation, presentation and organisation of…

Q: Is it better for a fatty acid to be less stiff or more stiff? How does the function change based on…

A: Fatty acids are the units of fat in our body, and it consists of an aliphatic hydrocarbon chain with…

Q: What are the predisposing factors, clinical manifestations, and management of otitis media?

A: Otitis media is infection of ear in which air-filled space behind the eardrum. This is cause by…

Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? Living things…

A: Introduction  Cells are the primary structural and organisational unit of all living things,…

Q: c) If persons 1 and 2 have children, what is the probability that their second child will have the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: One possible theme of The Call of the Wild could be that only the strongest survive. Explain how…

A: According to Darwin  theory, individuals with traits that enable them to adapt to their environments…

Q: 6. Do all outer cell membrane surface receptors bind G-proteins? 7. What is an example of a hormone…

A: Cellular receptors are proteins either inside a cell or on its surface, which receive a signal.

Q: Which of the following phenomena exhibit mitosis? All of the above The development of an embryo to…

A: A kind of cell division called mitosis occurs when one cell divides into two genetically identical…

Q: 5. Responsible for cell movements in eukaryotic cells: a. ribosomes  b. lysosomes  c.…

A: Introduction  The word "cell" comes from the Latin word "cellula," which signifies a small…

Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…

A: A checkpoint is a stage in the eukaryotic cell cycle where the cell examines internal and external…

Q: Hydroxyl ion (OH) is a type of the following: O a Acid O b. Base OC Buffer Od. Salt Oe. None of the…

A: According to Lewis concept Acids the those substances which can accept electrons while bases are…

Q: How is neurotransmission of pain signals modulated at the receptor, spinal cord, and brain?

A: Acetylcholine is a neurotransmitter that is synthesized from acetyl-CoA (ACoA) and choline obtained…

Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…

Q: 7. 1 Required Study the two diagrams below. Diagram A 1 2 Diagram B 2 Based on the sequence of steps…

A: Active transport is a type of transport process that helps to move molecules through the cell…

Q: Plant Cell Wall Plant cell cytoskeleton Plant Cell (Plasma) membrane Plasmodesmata of the Plant Cell…

A: Introduction :  Cells are the basic structural and functional units of all living beings. A cell can…

Q: C. In 1928, Sir Alexander Fleming was studying Staphylococcus bacteria growing in culture dishes. He…

A: Bacteria are prokaryotic microorganisms very much capable of causing a disease. On the other hand,…

Q: How does the cell membrane help maintain water content homeostasis?

A: Introduction  To attain balance, the body is continually attempting to control its internal…

Q: Initially, she may present her data and condusions at a scientific conference whe tists. Later, she…

A: Science is the coolest subject that revolves around every testable and prediction around the world.…

Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase? O…

A: The cell cycle is defined as the progression of the cells to various phases to undergo cell…

Q: Can you test the activity of topoisomerases doing in vitro assays? How?

A: Topoisomerases are the nuclear enzymes which play an essential role in the process of DNA…

Q: What is the purpose of fixing a smear? Mark all that apply: 1. To attach the bacteria to the slide…

A: The staining of microorganisms is very much important that helps us in identifying the morphology…

Q: Provide an explanation for the occurrence of the afterimage based on events occurring in the cone…

A: Introduction The human eye is the organ of the visual system which has the ability to receive visual…

Q: Why is it essential that smears be air-dried?  Why can’t they be gently heated over a flame to speed…

A: Introduction :  A bacterial smear is a tiny amount of culture that has been applied to the slide's…

Q: The following has a pH greater than 7 (>7): O a. Acid O b. Base O c. Buffer O d. Salt Oe. None of…

A: pH is measured as the negative log of hydrogen ion concentration. pH = - log(H+)  pH is the measure…

Q: 3. The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…

A: Introduction  The study of a specific trait that is passed down from one generation to the next is…

Q: You expect that a lung tumor cell line has arisen due to aberrant expression of the growth factor…

A: Cancer is due to the uncontrolled proliferation of the cell. This uncontrolled proliferation is…

Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…

A: The simplest definition of gene expression is the production of the gene's complementary protein,…

Q: Below are six faces. Each face represents a species. Seven characters are listed in the table, along…

A: Introduction :  Maximum parsimony is an optimality criterion in phylogenetics that favours the…

Q: A blue eyed agouti hair male mouse is mated to a brown eyed yellow haired female mouse, and a test…

A: Introduction  The term "phenotype" describes an organism's observable physical characteristics, such…

Q: How does skeletal system and muscular system work together?

A: Skeletal system:- skeletal system represent the internal framework of the body which is composed of…

Q: The core theme of biology that is: evolution. True False considered as the unifying theme of the…

A: Answer : True

Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? O Cells are the…

A: Mitosis and meiosis are the two types of cell division processes by which new cells called as…

Q: Viruses display all the characteristics of living organism but many scientists do not consider…

A: A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either…

Q: A(n) A B C is a bit of information that is true. opinion fact data

A: Science is the study area involving the study of nature and natural organisms. It is based on proven…

Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…

A: A cell cycle is the sequence of events that occur in a cell as it grows and divides.

Q: example of the fundamental concept of glomerulus.

A: Ans: Glomerulus is the filtering unit of kidney and composed of small blood vessels (capillaries),…

Q: Name 5 different physiological systems that are influenced by drugs

A: Drugs cause a brain reaction that alters how the body feels. The brain, which serves as the body's…

Q: Is the Triple-Sugar Iron Agar (TSIA) a complex or defined medium? Explain based on its composition.…

A: Introduction A solid or liquid substrate that can be used to grow cells or organ explants; a medium…

Q: Describe the difference between the artificial selection of organisms and genetically modifying…

A: Genetic engineering is a process in which genetic material is manipulated by man invitro for the…

Q: Which will happen during anaphase? Sister chromatids align at the metaphase plate Chromosomes start…

A: Introduction  When a parent cell divides into two or more daughter cells, this process is known as…

Q: You are reading a scientific paper regarding the relationships of the anatomical and behavioral…

A: Introduction  Evolution is the gradual change in the inherited traits of biological populations over…

Q: Which of the following phenomena exhibit mitosis? A lobe of the liver can regrow after it is…

A: Cell division is a phenomenon takes place inside the cell in which main ( parent ) cell split so as…

Q: Which set of facts is true for vaccines? They produce active immunity. They are mostly targeted…

A: Vaccination is a simple, safe, and effective method of protecting people from potentially fatal…

Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…

A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…

Q: (a) Copyright © 2003 Pearson Education, Inc., publishing as Benjamin Cummings. What is the…

A: Chromosomes are thread-like structures in the nucleus that contain tightly packed DNA. It can also…