Part II: Information TransferBackground Information - Key PointsThe background information provided for this lab has given you a general overview of some of 24the key terms and definitions necessary to understand the transfer of information from gene toprotein. The information included below will help you work through the specific problemsincluded in your Tutorial 4 Assignment. When working on the problems remember the base mu topairing rules (Table 3).Table 3: Rules for nucleotide base pairing.cytosine (C) - guanine (G)adenine (A)- thymine (T)DNARNAFor Transcription:●●●●cytosine (C) - guanine (G)adenine (A)- uracil (U)Initiation is determined by therecognition of the promotersequence in the DNA by the RNApolymerase.StefThe transcription start site isdownstream of the promoter and isdesignated as the +1 site.Aspartic acidAlaninaValineArginineSerineLysineAsparagineGlutamicTEOPO|0C|AGUCAG|UC|AG/DCAG/3G/CAGUCUGUA CAThreonineGMethionineIsoleucineSerineArginineGlutamineUUGACU GACU GAC OTOCkTyrosineHistidineStopCysteineStopTryptophan1040LeucineProlineFigure 1: Wheel depicting codons of mRNA thatspecify a given amino acid. Refer to Figure 14 in theLab 4 background information if you prefer thisinformation displayed as a chart.The transcript always begins at the+1 base (there is no 'zero' base; thesequence is ... -2, -1, +1, +2 ...etc.The mRNA of eukaryotic organisms is modified by the addition of a 5' cap and a 3' poly-Atail, the removal of introns and the joining of exons.For Translation:The start site is the first AUG codon downstream from where the ribosome binds.Nucleotides are read as single units (bases) until the first AUG (start) is encountered.Thereafter, nucleotides are read in groups of three (codons) until the first stop codon isencountered.Codons are translated into amino acids (typically including the START codon beforepost-translational modifications) as specified in the genetic code (Figure 1).• Polypeptides are synthesized from the amino terminus to the carboxyl terminus by theaddition of new amino acids to the carboxyl terminus.IIIIIII1II IIIIII1I1Below is a sequence of eukaryotic DNA containing a hypothetical gene. The base that is first (atthe 5' end) in the sequence is at position -15. Remember that DNA sequences do NOT have aposition 0. The translational start site is the first initiating codon (start codon) encounteredafter the transcriptional start. This gene has three exons. The last base of the first exon is theG at position + 31, the first base of the second exon is the Tat position +60; the last baseof the second exon is the T at position +83; the first base of the third exon is the A atposition +108; the last base of the third exon is for you to determine.5'- TATATACTGT ATGGTGGGTT GATCTATGTA TCAACAGTAC GGCTCGCAGG TACCCGATGAGATGGGAAGG TGGGTTGACA GCTAGCAGTA GCGACAGTTT AGATTAGTCG TACGCGATATTTACGGCCCA TGAGTGAAAA AAGGTGCTCG CGATTCCGTC GAGTTCCAAGC TTTAGCTAGTTTTAGCGGGAG GTACCCGATT AGCTATGGCT GATCGATCGC TAGCATCGAT TGGACTAGGATTGTGGCTTA -3'5. Beginning with the start codon, what are the first 20 nucleotides of your mRNA sequence'6. What is the sequence of protein you have translated (specify the amino and carboxyltermini)thymine7. A mutation occurs in the original DNA strand for protein X such that the+61 is deleted. What is the effect of this mutationpositioncytosine8. A mutation occurs in the original DNA for protein X strand such that theWhat is the effect of this mutationposition +48 is changed to anucleotide atthyminenucleotide inI

Question

Accepted Answer

Introduction : 
The genetic code is a system of rules that living cells use to interpret the…