1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutat Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA O C. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA

1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutat Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA O C. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 20P: Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand...

See similar textbooks

Related questions

Q: Neutrophils travel through the body in interstitial fluid. True False

A: Neutrophils are a type of white blood cell that play a critical role in the immune system's response…

Q: You performed an oxidase test and the positive test result occurred after about 5 minutes after…

A: In biology, biochemical tests are performed to identify the species of bacteria on the basis of the…

Q: Know the 3 survivorship curves. How is a food chain different from a food web? Why is transfer of…

A: There are many questions and we are allowed to answer only three at a time.Let's look into your…

Q: This fungus is a common bread mold. O C. albicans O A. niger O A. flavus O P. notatum O R.…

A: Candida albicans is a type of yeast and one of the most common fungal species found in the human…

Q: One way to detect alternative splicing of transcripts from a given gene is to compare the sequences…

A: Alternative splicing is a post-transcriptional process that occurs in eukaryotic organisms, allowing…

Q: What is a potential consequence of embryonic exposure to endocrine-disrupting compounds that can…

A: A potential consequence of embryonic exposure to endocrine-disrupting compounds that can bind to…

Q: Procedure 1: Bacteria Shapes Bacterial cells come in three shapes. Study the shapes in Figure 9.1…

A: Bacteria are primitive prokaryotic unicellular microscopic life forms. A single cell carries out all…

Q: 6) of the following metabolic processes, which one is common to or a characteristic of…

A: Photosynthesis is the process by which plants produce their own food by combining water and carbon…

Q: of DNA replication. Beginning of replication End of replication

A: DNA replication is the process by which a cell makes an identical copy of its DNA. During…

Q: Which of the following is an accurate description of the genotype in the top left square of the…

A: Homozygous dominant refers to a genetic condition where an individual has two copies of the dominant…

Q: Which type of disorder is most difficult to correct by gene therapy? an incompletely dominant…

A: Researchers are constantly trying to come up with novel solutions to the problems brought on by…

Q: Select the row that correctly identifies Hormones X and Y. Row A. B. C. Gland A Hormone X Gland B…

A: The Hypothalamic–pituitary–adrenal (HPA) axis is a set of interactions between the hypothalamus,…

Q: 1. Pigment in mouse fur is only produced when the C allele is present. Individuals of the ce…

A: a. AaBbCc x AaBbCcThe parents have the genotypes AaBbCc and AaBbCc. When determining gametes,…

Q: Give only typing answer with explanation and conclusion If the pOH of the small intestine is 5.9,…

A: Understanding the acidity or alkalinity of a solution involves understanding its pH, pOH, and the…

Q: Use the codon sequence to translate the following mRNA sequence (start with the start codon - AUG -…

A: Genetic codons are sequences of three nucleotides (nitrogenous bases) found in messenger RNA (mRNA)…

Q: Which of the following describe what enzymes such as Chymotrysin accomplish to allow products to…

A: Answer : the enzymes such as Chymotrysin accomplish to allow products to form and be released by the…

Q: With the research question: Will the number of bubbles per minute increase or decrease as the light…

A: Photosynthesis is the process by which plants use light energy to convert carbon dioxide and water…

Q: Please match the terms regarding immunotherapies with their definitions. Please match the terms…

A: Let's match the following:

Q: conclusion Which of the following is a “Group” of photoautotrophic eukaryotes that are believed to…

A: Photoautotrophic organisms are those organisms that are able to prepare their own food with the help…

Q: What is the purpose and basic rules of ICD-10-CM coding, identifying correct principal and primary…

A: ICD-10-CM (International Classification of Diseases, 10th Revision, Clinical Modification) is a…

Q: The trp operon in E. coli is a negative repressible operon. This implies that... a. The trp…

A: The correct answer is:c. The trp operon makes use of a repressor and can be turned "on" (i.e., is…

Q: Which virus causes a disease that has some similarities to chicken pox but is not in the Herpes…

A: Chicken pox is a highly contagious viral disease characterised by rashes and fever. It can be spread…

Q: determine what type of interaction the example is describing 1. Pilotfish remove and eat parasites…

A: Ecological interactions are the relationships and connections that occur between different organisms…

Q: What is the substrate for salivary amylase? Select one: a. Protein b. Saturated fatty acids c.…

A: The enzyme Salivary amylase is found in the saliva of humans. It is secreted by salivary glands,…

Q: Which of the following compounds prevent cellular damage by reactive oxygen species? Select one: a.…

A: Cellular damage refers to harmful changes that occur within cells, affecting their structure,…

Q: Which of the following fungi is known to cause yeast infections? O C. albicans R. stolonifer O A.…

A: *Yeast infections can be commonly known as candidiasis, which are frequent fungal infections caused…

Q: Cholinesterase is an enzyme that breaks down acetylcholine in the synapse. What would be the result…

A: The interaction between acetylcholine and cholinesterase plays a significant role in the functioning…

Q: The Achilles tendon reflex is observed when the Achilles tendon of a person is tapped with a…

A: The Achilles tendon reflex is a reflexive response that involves the interaction of sensory and…

Q: Please read the scenario below and answer the question (in bold) that follows: In humans, the…

A: To determine what gametes the mother produces, we need to consider her genotype. The scenario states…

Q: Why do cancer cells treated with vitamin E succinate appear to be more vulnerable to rupture of…

A: Cancer cells are abnormal cells that have undergone uncontrolled and unchecked growth, leading to…

Q: Art-Labeling Activity: Organization of the parasympathetic nervous system Drag the appropriate…

A: The body's communication system, the nervous system, is a complicated web of cells and tissues. It…

Q: What gametes are produced by a Cyclops with the genotype BBPp? a. BB b. Pp c. BP and Bp…

A: Need to find the gametes produced by a cyclops with genotype BBPp.There are two alleles for each…

Q: For each of the listed modes of single gene inheritance (assuming complete penetrance), indicate…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: ven the samples below: Taproot Fibrous root

A: All the roots are formed by radicle part of the plant embryo. The main function of the roots is to…

Q: Name one way that genetics can play a role in the first line of defense.

A: Immunity is the ability of the body to fight off infection due to the presence of particular…

Q: Please read the scenario below and answer the question (in bold) that follows: An aquatic arthropod…

A: To answer the questions, let's first assign the alleles for each trait:Antenna type: Barbed (B) and…

Q: Which of the following describe energy unavailable to do cellular work? Group of answer choices…

A: The energy which is unavailable to do cellular work is : entropy

Q: The tRNA molecule shown above would be found in the Row A B. C. 3. B D. ect one: A. A i nucleus…

A: Translation is the process by which a certain protein is encoded by an mRNA. The ribosome converts…

Q: Which bacterium listed is the cause of Lyme disease? O E. coli OB. anthracis O B. burgdoerferi O B.…

A: Infection due to the spirochete bacteria say, Borellia burgdoerferi( North America), B garinii, B…

Q: Which of the following proteins is categorized as an integral, lipid-linked membrane protein? band…

A: Plasma membrane is the outer boundary of the cell that encloses the cytoplasm of the cell. It is a…

Q: sympathetic chain ganglion postganglionic craniosacral thoracolumbar cholinergic preganglionic…

A: The autonomic nervous system is one of the main part of the nervous system. It deals with certain…

Q: example of Period prevalance Point prevalence Mortality rate

A: Flu is an infectious viral disease which is easily spread by contact. If a person is affected with…

Q: Classify each statement as true or false. A mating between SS and Ss individuals will result in all…

A: Dominant allele is able to express itself even in the presence of its recessive allele. Its effect…

Q: Following a mutagenesis experiment to identify novel genes affecting the circadian clock in…

A: When two mutatnt organisms with same phenotypes are crossed and produce offspring with a wild type…

Q: Figure 4 illustrates the sexual and asexual reproduction of yeast. Meiosis Diploid phase Spore 86…

A: Fungi are heterotrophic organisms that are unable to prepare their food like plants as they are…

Q: What is the best way to skin a caktus to make lemonade?

A: The succulent family Cactaceae, which includes roughly 127 genera and 1750 recognized species in the…

Q: The reproductive structures that are affected by CAVD are Select one: OA. b, f and g O B. d, g, and…

A: Congenital Bilateral Absence of the Vas Deferens, a condition affecting male reproductive structures…

Q: Which of the following membrane transport proteins would you expect to be the most selective at…

A: The fructose carrier protein, also known as the GLUT5 transporter, is a specialized membrane protein…

Q: 9 Which of the following statements about transcription is not true? In both prokaryotes and…

A: Transcription is the process by which genetic information encoded in a gene's DNA sequence is copied…

Q: Select all that apply: Which items listed are found in the third line of defense? O Fever O T…

A: A vast network of organs, WBCs, proteins (antibodies), and chemicals make up the immune system.…

Question

100%

1
An Amino Acid Sequence
Leu - Tyr - Gly-Gly - Val
Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation?
Select one:
O A. CUC UAG GGU GGC GUA
OB. CUC UAC GGG GGC GUA
OC. CUC UAC GGU GGC GCU
O D. CUC UAU GGU GGC GUA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Identify the amino acids in the given sequence

VIEW

Step 2: Compare the mRNA sequences in the options to the given sequence

VIEW

Step 3: Explanation for incorrect answers

VIEW

Solution

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
Explain The mRNA codon of valine is: GUC UGG CCA TTG
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
If the following truncated peptide represents the active domain of the COVID19’s S-protein N-terminal ----Leu-Leu-Gly-Cys-Ile-Glu-Ser-Thr-Cys-Ala ------ C-terminal a) state the RNA sequence of this peptide given that Leu is the first amino acid b) show a point mutation using the RNA sequence & explain how it results in silent mutation effect c) show a deletion mutation using the RNA sequence & explain the consequence(s)
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′