Answered: 1 and 4 3 and 4 4 1 and 3 3 In the…

Science

Biology

1 and 4 3 and 4 4 1 and 3 3 In the diagram, myelinated neurons are represented by the numbers O2 and 5 2 5

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter13: Nerves Of Steel

Section: Chapter Questions

Problem 6WS

See similar textbooks

Related questions

Q: Identify the following (explain in 1-3 sentences): Description: Embryonic origin : Function :…

A: The term "embryonic origin" describes the tissue or cell type through which a specific organ or body…

Q: What is one anatomical trait that is present in both Adapoids and Omomyoids? A. A bony ear tube…

A: Adapoids are relatives of current day lemurs, lorises and bushbabies. They lived during the Eocene…

Q: Question 14 The scientist (scientists) who used enzyme-digesting proteins to show that protein was…

A: Dear student,As per the Bartleby policy, I am answering the first question only. To answer the…

Q: Part 1: In the image below (Figure 2) which way will water go? Describe why in 1-2 sentences using…

A: Solution is a formed by a combination of solute and solvent.There are three types of solution…

Q: Determine whether Staphylococcus saprophyticus and Serratia marcescens are gram-negative or gram…

A: On the basis of the staining procedure called Gram staining, bacteria can be classified as gram…

Q: *Ms. Libby Davison bought three Congo Lily bulbs at a flower show after she was told they were each…

A: R for Red alleleY for Yellow alleleW for White allele

Q: How can a skull of a specimen be classified as a Strepsirrhine?

A: Strepsirrhine are identified by their long snout and wet nose. This group includes lemurs and…

Q: 1.state the principle and uses of real time pcr and microtiter plate 3.state two uses of distilled…

A: Real time PCR is based on the accumulation of amplification products. The quantification of these…

Q: Drag the text blocks below into their correct order. Immediately after double fertilization, the…

A: A eudicot, scientifically known as a eudicotyledon or eudicotyledonous plant, is a type of flowering…

Q: What is osteoarthritis

A: The skeletal system is the support system of the body that provides shape and structure to the body.…

Q: 1. Draw 8 phospholipid molecules arranged to show how the phospholipids will orient themselves on…

A: Phospholipids are the biomolecules that act as the main constituent of cell/plasma membranes.These…

Q: QUESTION 28 Iodine is needed for proper thyroid function. 20 mg is a typical amount of iodine in a…

A: The interconnected disc like structure which is present in internal membrane of chloroplast is known…

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…

Q: A peptide is produced in two different cells. The primary structure is the same in both cells, but…

A: Polyadenylation:Increases the stability of the mRNAIt is essential for translational…

Q: In transformation, a bacterial cell takes up DNA fragments from its surroundings. The figure shows…

A: Bacteria transform themselves by ingesting DNA from their surroundings. Griffith first outlined this…

Q: Why is the precise timing of recombination events critical during B and T cell development?.

A: B and T cell development is the complex biological process through which precursor cells mature into…

Q: 1.) Starch is partially digested into maltose by the action of____?

A: Starch:- It is a branched chain of D-glucose units.- It is the storage form of glucose in plants.-…

Q: What is the amount of these gases ( O2 , N2O , Air 4 bar , Air 7 bar ) that should the patient…

A: The quantity of gases administered to a patient in a hospital is contingent on several factors,…

Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…

A: The correct answer is option D. Sex-linked recessive.

Q: When completing a chart showing the organization of the nervous system, which term should be written…

A: The central nervous system ( CNS) comprises the brain and the spinal cord. The peripheral nervous…

Q: The largest and most complex mitochondrial genomes come from fruit flies. humans. mice. O flowering…

A: The DNA found in mitochondria, which are essentially cellular organelles in eukaryotic cells that…

Q: Based on morphological data, explain which early euprimate is thought to be ancestral to modern…

A: The study of early euprimates, the group that incorporates modern primates and their closest extinct…

Q: an F2 generation. If there are a total of 200 F2 flies, how many of the F2 females are expected to…

A: A character is autosomal linked when the gene is present on autosomes and the character is X linked…

Q: Part A: To which other species of storm-petrel is H. matsudairae, the cold-season breeder on Japan,…

A: Phylogenetic trees are evolutionary diagrams that depict the relationship between organisms of…

Q: Which of the following is directly responsible for the development of the clitoris and labia? Select…

A: Clitoris and labia are female sex organs. When the fetus is present inside the wound lots of changes…

Q: Propose a principle of how LDL-C and VLDL-C can be precipitated out from serum.

A: The isolation and quantification of specific lipoproteins like LDL-C (Low-Density Lipoprotein…

Q: Part A If E. coli bacteria are placed in an environment that contains both glucose and lactose, the…

A: When glucose concentrations are low, E. coli can use other sugars as fuel. The c AMP-CAP protein…

Q: Why is it important to first determine whether growth occurred in a different medium, such as starch…

A: Culture medium can be described as a liquid or gel medium which provides minerals and nutrients to…

Q: Match each structure with the region of the blood vessel wall where it is found. Prompts Collagen…

A: These are the structures those carry blood through tissues and organs. They act as channels carrying…

Q: rown atrophy H&E staining Mark the corresponding elements in the picture: 1 - liver beams 2 -…

A: The liver can be susceptible to various pathological conditions that cause atrophy. One such…

Q: Briefly explain what occurs in G1 phase including how and why this phase is important in the cell…

A: A cell cycle is a structured and monitored process by which one single parental cell functions,…

Q: What letter in the diagram identifies the sporophyte? Which letter in the diagram indicates the…

A: The diagram illustrates the alternation of generations, a common life cycle observed in many plants…

Q: Part II. Basic Body Plans Cross Section of Planaria Cross Section of Roundworm

A: A cross section or T. S also known as an axial plane is obtained by dividing the body into head and…

Q: words, describe the differences you see for each organism grown at 30 C or 37 C (i.e., amount of…

A: Microorganism have their own optimal growth at an optimum tempearture and pH. In these pictures, we…

Q: Classify the examples as pre‑zygotic or post‑zygotic barriers.

A: Prezygotic barriers prevent mating or fertilization, while postzygotic barriers prevent the…

Q: One reason that the osmolarity becomes higher at the bottom part of the loop of Henle is because A)…

A: Henle's loop is a long, U-shaped section of the kidney's nephron tubule found in mammals, birds, and…

Q: Answer the following (explain in 1-3 sentences) Description: Embryonic Origin: Function: Location in…

A: Tissue is a group of similar cells that usually have a common embryonic origin and function together…

Q: Which bacterium is a psychrophilic anaerobe? A. Desulfuromusa B. Flavobacterium C. D. Escherichia E.…

A: Basic introduction to -Psychrophilic anaerobes.Anaerobes are bacterial organisms that can survive…

Q: Protein processing pathway Match each description with the appropriate step in protein secretion.…

A: Proteins are produced by the ribosome by the translation process. Ribosomes bound on the membrane of…

Q: Suggest an experiment to determine if the uptake of a compound is by either facilitated or active…

A: The cell membrane or plasma membrane is the outermost layer that encloses the cellular contents. It…

Q: In fruit flies, gray is dominant over ebony body color and wild is dominant over curled wings. A…

A: In genetics, a test cross is a cross that involves an individual of interest, usually with an…

Q: Which of the following concept maps correctly describe the relationship among these four terms -…

A: Genomic is field of study which is used in order to comprehend the structure as well as the function…

Q: 1. Which of the following could most quickly reverse calmodulin activity ? ADP A plasma membrane…

A: Calmodulin (CaM), also known as calcium-modulated protein, is a multipurpose intermediate…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: A normal cell has no growth factor bound to the growth factor receptor. What do you predict about…

A: The extracellular signal-regulated kinase (ERK) pathway is an important pathway that cells use to…

Q: Select ALL of the conclusions that can be drawn from this graph. A Species 1 Seed size Select all…

A: Competition is the relationship where two species compete with each other to survive better.Here…

Q: Match the hypersensitivity to the example, each type can be used more than once or not at all. ✓ Hay…

A: Hypersensitivity is the reaction of the immune system to certain substances resulting in allergic…

Q: These structures allow a bacterium to move through an aqueous environment: spores cilia flagella…

A: Microbes have evolved a wide range of specialised structures, such as spores, capsules, fimbriae,…

Q: Most eukaryotic genes are normally inactive and require positive regulation. Determine whether the…

A: In eukaryotes when genes need to be turned on and transcribed into m RNA and proteins, this process…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Question

1 and 4
3 and 4
4
1 and 3
3
In the diagram, myelinated neurons are represented by the numbers
O2 and 5
2
5

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Nervous system

VIEW

Step 2: Different types of nerve cells and their characteristics

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following voltages would most likely be measured during the relative refractory period? +30 mV 0 mV -45 mV -80 mv
Glia that provide myelin for neurons in the brain are called _____________. Schwann cells oligodendrocytes microglia astrocytes
Neuronal integration refers to the ability of neurons to respond to the combined effect of several EPSPs and IPSPs True False
Gray matter consists of... cell bodies, dendrites, and unmyelinated axons myelinated axons unmyelinated axons myelinated cell bodies, dendrites, and axons
The giant axon of the squid (Figure Q11–3) occu-pies a unique position in the history of our understandingof cell membrane potentials and nerve action. When anelectrode is stuck into an intact giant axon, the membranepotential registers –70 mV. When the axon, suspended in abath of seawater, is stimulated to conduct a nerve impulse,the membrane potential changes transiently from –70 mVto +40 mV.
Continuos propagation of action potentials occurs in myelinated axons and is faster than conduction in unmyelinated axons. True False
Gaba spillover from the inhibitory synapses can activate heteroreceptors and block presynaptic calcium channels in the excitatory axonal terminals TRUE OR FALSE Don't copy from Google
Distinguish between insulation by oligodendrocyte or Schwann cells. Relate myelination to signal speed. Describe the myelin-related terms: neurilemma, nodes of Ranvier, internodes, nonmyelinated
A change in the axon membrane potential from -70 mV to -64 mV would be called a depolarization polarization hyperpolarization potential
In discussing nuerites, neurons typically have one __, but many ___. A. Axon; dendrites B. Dendrites;axons C. Cell body; axons D. Dendrites; cell bodies
Stellate cells initially process sensory input to the cortex, whereas pyramidal cells send fibers from the cortex to terminate on efferent motor neurons. (True or false)
View the University of Michigan Webscope (http://openstaxcollege.org/l/nervefiber) to see an electron micrograph of a cross-section of a myelinated nerve fiber. The axon contains microtubules and neurofilaments, bounded by a plasma membrane known as the axolemma. Outside the plasma membrane of the axon is the myelin sheath, which is composed of the tightly wrapped plasma membrane of a Schwann cell. What aspects of the cells in this image react with the stain that makes them the deep, dark, black color, such as the multiple layers that are the myelin sheath?