Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends 2. All 5’-phosphate ends 3. leading strand (s) 4. lagging strand (s) 5. Okazaki fragments (draw 3) ❏ RNA primer(s) 6. direction of replication ❏ replisome(s) 7. origin (s) 8. terminus (i)

Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends 2. All 5’-phosphate ends 3. leading strand (s) 4. lagging strand (s) 5. Okazaki fragments (draw 3) ❏ RNA primer(s) 6. direction of replication ❏ replisome(s) 7. origin (s) 8. terminus (i)

Name: Draw a diagram of a single replication fork. Label the following on yo
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends2. All 5’-phosphate ends3. leading strand (s)4. lagging strand (s)5. Okazaki fragments (draw 3) ❏ RNA primer(s)6. direction of replication ❏ replisom

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
. Draw a replication bubble with both replication forksand label the origin of replication, the leading strands,lagging strands, and the 5′and 3′ ends of all strandsshown in your diagram.
Draw a replication bubble with both replication forks and label the origin of replication, the leading strands, lagging strands, and the 5' and 3' ends of all strands shown in your diagram. Pls help asap!
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown. 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)
What statement(s) apply to both eukaryotic and prokaryotic replication? Select all that apply. a. There is a single origin of replication. b. Replication is discontinuous on the lagging strand and continuous on the leading strand. c. The sliding clamp is composed of PCNA. d. Telomeres are replicated by telomerase. e. Helicase unwinds the helix. f. Replication is continuous on the lagging strand and discontinuous on the leading strand.
Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?
When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G
Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.
Which of the following most correctly describes a process that occurs during DNA replication? Group of answer choices Replication of the lagging strand occurs in the 5' → 3' direction—the leading strand in the 3' → 5' direction. Replication is continuous on the lagging strand and discontinuous on the leading strand. Okazaki fragments are DNA fragments synthesized on the lagging strand. DNA polymerase adds dNTP monomers in the 3′–5′ direction. Replication is continuous on the lagging strand and discontinuous on the leading strand.
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.