1. Describe how each of the following modes of analysis may be used to measure enzyme activity: end point multipoint kinetic 2. List examples of the synthetic, metabolic, and excretory functions of the kidney. 3. Calculate a creatinine clearance and its reference range. 4. Explain the biochemical formation of creatinine, urea, and uric acid.
Q: An infant was admitted to hospital for failure to thrive. It was discovered that the infant lacks…
A: Saturated fatty acids undergo beta oxidation in the mitochondria. A fatty acids with 'n' carbons…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially…
A: In E. coli genetic information is stored in form of DNA. E. coli DNA is circular in shape. DNA…
Q: An N-linked glycoprotein contains a glycan covalently linked to which specific amino acid in a…
A: N linked glycosylation is the process in which an oligosaccharide molecules are attached to proteins…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True…
A: Proteins are the biological molecules with great diversity in structure and function. They are made…
Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…
A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: what is the net reaction of the citric acid cycle for a single acetyl coenzyme A molecule? what are…
A: TCA cycle is also called as Krebs cycle a cyclic process that converts Pyruvate to CO2. It is a…
Q: Which of the following mutations is most likely to cause a loss of protein function? O a. Silent…
A: As per the central dogma of biology, the genetic information stored in the DNA is copied onto an…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Question 20 Signal sequences are often found at the C-terminus of the polypeptide chain. True ●…
A: Proteins are polypeptide chains that are made up of amino acids. They are synthesised during…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: myristic acid (14:0) carbon dioxide and water a. how many moles of ATP produced from 1 round of the…
A: Myristic acid is found in human cellular membranes at much lower levels than its longer chain…
Q: Adipose triglyceride lipase (ATGL) hydrolyzes a fatty acyl group from: A) monoacylglycerol. B)…
A: ATGL is adipose triglyceride lipase is an enzyme of lipolysis. It helps in hydrolysing the fatty…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Glucose , sucrose, lactose, starch all are carbohydrates. Glucose is the simplest carbohydrate of…
Q: C) using Fischer Projection, draw each for the payoff phase of glycoly in 6.) G13 P 1, 3-bPG 3) 3PG…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: Indicate whether each of the following is due to an increase in pH, a decrease in pH or neither and…
A: pH is defined as the measure of acidity or basicity of a solution. In general, pH is inverse…
Q: As we grow up or old, metabolism gets faster or slower?
A: Metabolism is the process that involves catabolism and anabolism . These are the reactions during…
Q: What charge at pencentage of the Histidane side chain will PH = 7₁4? Cerrry No.
A: His is basic polar amino acids and His contains imidazole as side chain group. pKa of His is 6. pH…
Q: By the reaction catalyzed by the pyruvate dehydrogenase complex: a) NAD+ is oxidized to become NADH…
A: The glycolytic process results in pyruvate, which is a substantial source of acetyl-CoA for the TCA…
Q: For the electrophoresis at 25°C of two proteins, in a medium with a viscosity of 0.001kg/m-s, the…
A: Electrophoresis is a technique used in biotechnology to separate and analyze biological molecules…
Q: You are studying a metabolic pathway and are trying to decide if it is an anabolic pathway or a…
A: Catabolic pathways are those that can breakdown the larger compounds into simple molecules. Anabolic…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: What charge does a protein molecule have? O neutral O positive O negative O The charge depends on…
A: Diffusion and osmosis are 2 processes that depict the movement of substances from higher…
Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…
A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Give one example of a disease and briefly explain the molecular basis of the disease. apply the…
A: INTRODUCTION : Diseases and pathological conditions : A disease is a pathological condition in which…
Q: What does an area of clearing indicate in biochemical test?
A: Measuring a nutrient or its metabolite in the blood, faeces, urine, or other tissues that have a…
Q: Question 24 Which of the following is not a cell surface receptor? GPCR DNA-associated receptor RTK…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: In term of the sugar identity , what is the difference between DNA and RNA. 2 What nucleobases are…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two of the most important molecules in…
Q: Which of the following is true about myoglobin and/or hemoglobin?nd a. The iron in hemoglobin is in…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: Which of the following is not a characteristic of DNA replication? O The synthesis of DNA is…
A: DNA carries all the genetic information needed to make an organism. DNA contains genes which are the…
Q: What is the catalytic triad on chymotrypsin? Detail its importance.
A: Proteases are hydrolytic enzymes that cleave peptide bonds that link two amino acid residues…
Q: Question 7 Which of the following translocases serves as the central entry gate for cytosolic…
A: Mitochondria is a cell organelle whose purpose is to generate ATP via oxidative phosphorylation. It…
Q: For Gal(Beta 1 - 4)Glc, Explain in detail the glycoside bond: What carbon involved in glycoside…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: how do we name the bond between monomer B and monomer C
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which of the following is NOT a secondary database for structural classification of proteins?…
A: Proteins are polymers of amino acid that have five functional role. Protein databases are…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: a. Calculate the physiological DG of the reaction shown below at 37°C, as it occurs in the cytosol…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Which of the following polypeptides would be most likely to form an a helix? Explain your answer.…
A: A polypeptide chain folds into a protein in its native, three-dimensional form through a process…
Q: B. Given that five molecules of glucose in eukaryotes underwent full oxidation and entered ETC, how…
A: ATP is the energy currency of the cell also known as 'molecular unit of currency', where it breaks…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…
A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…
Q: The hormone, glucagon, is released in the body when glucose levels are low. Briefly describe how…
A: In response to changes in blood glucose levels, the pancreatic cells secrete two peptide hormones:…
1. Describe how each of the following modes of analysis may be used to measure enzyme activity:
- end point
- multipoint
- kinetic
2. List examples of the synthetic,
3. Calculate a creatinine clearance and its reference range.
4. Explain the biochemical formation of creatinine, urea, and uric acid.
Step by step
Solved in 6 steps
- 1. Discuss the principles of the colorimetric and enzymatic methods for quantitating uric acid. 2. What are the causes of abnormal levels of serum uric acid?1. What is gluconeogenesis?2. Explain the biochemical effects underlying the metabolic functions of the renal system in gluconeogenesis as well as insulin metabolism3. What is the relevance of the above in the management of a patient with Chronic kidney disease and diabetes mellitus4. How does renal tubular disease or renal parenchyma disease affect the excretory and haemodynamic regulatory functions of the kidneys1. Characterize BUN/Urea in terms of metabolism. 2. The clinical correlation of BUN and creatinine in renal disease.
- 3. The dose of gentamicin for patients with impaired renal function is adjusted to ensure therapeutically optimal dosage. If the normal daily dose of the drug for adults is 3 mg/kg/day, administered in three divided doses, what would be the single (8-hour) dose for a patient weighing 165 lb and scheduled to receive only 40% of the usual dose, based on renal impairment? answer: 30 mg gentamicin I want to know the solutions please.1. Discuss the excretion and retention of proteins by the glomerulus. 2.If you are the medical technologist, which of the four methods of glucose determination would you employ? why?4, H+ secretion in the renal tubule happens by Multiple Choice It follows a negative ion like Cl- or PO43- H+/HCO3- exchanger in the basolateral membrane Na+/H+ exchanger in the apical membrane It first combines with HCO3- and is then regenerated in the tubular fluid
- 1. Using the mode! above, illustrate the urea cycle1) "Compared to those of similarly sized birds and lizards, the kidneys of mammals ______." A) "Compared to those of similarly sized birds and lizards, the kidneys of mammals ______." B) have a larger renal cortex but a smaller renal medulla C) have lower concentration of urea in their renal medulla D) have higher concentrations of Na+ and Cl- in their renal medulla1. when ADH level is excessive, the plasma concentration of sodium is __ while water retention is ___ a. none of these b. increased, increased c. increased, decreased c. decreased, increased d. decreased, decreased 2. Which of the following electrolyte is not measured in the laboratory? a. Inorganic phopshate b. potassium c. Magnesium d. Ionized calcium e. Organic Phosphate 3. In diabetic ketoacidosis. magnesium level renal excretion is __ while the plasma level is __ a. none of the choices b. decrease, decrease c. increase, decrease d. decrease, increase e. increase, increase
- 1. Mention at least 5 proteins, besides albumin, that are present in the urine under pathological conditions. 2. Differentiate pre-renal, renal and post-renal proteinuria and give one example of each. 3. Explain why glucose test that is normally reabsorbed in the proximal convoluted tubule may appear in the urine, and state the renal threshold levels for glucose.1. What are the different methods in determining BUN? 2. What are the principles of the colorimetric and enzymatic methods for quantitating urea? 3. What is the clinical significance associated with detecting abnormal level of urea in the blood?37. Which of the followings is correct about chloride reabsorption from the loop of Henle? A. Cl– is reabsorbed through the chloride channels of cells of the thick segment of loop of Henle B. Cl– is reabsorbed through paracellular gaps of the thick segment of loop of Henle C. Cl– is reabsorbed through Na–K–2Cl cotransporter in the basolateral membrane of the thick segment of loop of Henle D. All of the above is are correct E. None of the above is correct
