What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following sequence ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3
Q: Leu 93 Val 49. Are these two residues polar or hydrophobic (nonpolar)? What effect should their…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: which of the following types of information is provided by a suffix? A) numbers b) positions…
A: Prefix, root word and suffix are used to define and complete medical terminologies. Prefix is…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: During starvation, the glycerol backbone of triacylglycerols can be used to make glucose. What…
A: Gluconeogenesis is the pathway by which glucose is formed from non-hexose precursors such as…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: * You can keep extra decimal places through most of this problem, but round your final estimate to…
A: Spectrophotometry is a technique to measure the light absorption by a substance. It is classified…
Q: why is enzyme efficiency represented by kcat/Km rather than Vmax
A: Enzyme kinetics is the study of the rates of chemical processes that are catalysed by enzymes. The…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose…
A: Eukaryotic translation is the process by which eukaryotes synthesize polypeptide chains with respect…
Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: The Cori cycle involves the: OA) conversion of glucose to lactate in liver and lactate to glucose in…
A: The Cori cycle is also known as the lactic acid cycle. During muscular activity, when oxygen supply…
Q: Which of the following does NOT correctly describe the fluid mosaic model of lipid bilayer? A.…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: 8. [1-¹4C]Glucose Catabolism An actively respiring bacterial culture is briefly incubated with…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: *Determine the ATP yield from the metabolism of one molecule of glucose under the following…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Figure 1 shows the structure of adenine and thymine. (i) (ii) NH H adenine -H =C thymine Figure 1…
A: These are cyclic compounds that contain nitrogen. They can be: Purines: a heterocyclic organic…
Q: Balance the following net reaction that occurs during oxidative phosphorylation. Use the smallest…
A: Oxidative phosphorylation is the process where oxygen is reduced to generate ATP and water. NADH and…
Q: iccharide. A チ OH CH₂OH 3 OH 3 с loftes to right alpha-glucosidic Bond. B 6 CH₂OH H OH 2 OH H CH₂OH…
A: Carbohydrates can be classified into monosaccharides ,oligosaccharides and polysaccharides.…
Q: Focusing on the mechanism linking complex I and ATP synthase depicted in figure 3 in the article,…
A: Peter Mitchell in t the chemiosmotic theory proposed that there exists a membrane localized,…
Q: Which of the following factors favor fatty acid synthesis in liver cells when blood glucose levels…
A: The body utilizes carbohydrates as the primary source of energy. The excess carbohydrates after…
Q: Differentiate reducing sugars from non-reducing sugars in no less than 2 paragraphs. Provide…
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of…
Q: . a. Explain why the melting point of palmitic acid (16 carbons, no double bonds) is slightly lower…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Question 22 Which is not a structural motif for DNA binding? αβα motif Zn Finger leucine zipper…
A: Proteins are true polymers, which are composed of amino acid units. Proteins have four levels of…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: 1 what is the final electron acceptor in the electron transport chain 2 in oxidative…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: Using this information, offer some observation of the relevance of phosphorylation to the function…
A: ZIPs are a group of Protein channels that aid in the transfer of Zinc ions (Zn2+) from extracellular…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: 18. A biochemist has a 0.1000 L sample of a globin protein at a concentration of 0.0500 M. The P50…
A: Recall that: Fractional Saturation (θ) is the fraction of protein molecules saturated with a ligand.…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: Which of the following is true of signal transduction mediated by protein tyrosine kinases…
A: Signal transduction is the process of transmission of chemical or physical signal intracellularly…
Q: Which of the following statements is correct about chemiosmosis? Select one: O a. it makes…
A: Electrons generated during the oxidation of carbohydrates are carried by electron carriers such as…
Q: Erythropoietin (EPO) is a glycoprotein hormone that stimulates the production of erythrocytes in red…
A: Glycoproteins are proteins which contain oligosaccharide chains (glycans) attached to amino acid…
Q: How is osmosis different from simple diffusion? Oosmosis involves the movement of water, simple…
A: The two forms of passive transport that are essential for transporting molecules into and out of the…
Q: Which of the following is true about myoglobin and/or hemoglobin?nd a. The iron in hemoglobin is in…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: Which of the statement/s is TRUE of electrolytes? I. They are positively and negatively charged…
A: Electrolytes are substances present in the blood and carry an electric charge. Osmosis is the…
Q: Question 13 1 The binding of seven molecules of ATP at the apical domain of the GroES causes the…
A: Since you have asked multiple questions, we will solve the first question (Question No. 13) for you.…
Q: Which of the following polypeptides would be most likely to form an a helix? Explain your answer.…
A: A polypeptide chain folds into a protein in its native, three-dimensional form through a process…
Q: The following assays is/are considered a DIRECT ASSAY: A. absorbance B. рн C. Viscosity D. All of…
A: Process of analyzing a substance to determine its composition or quality is an assay. In medicine,…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: 1 what is the net reaction of glycolysis? 2 Starting with glucose ( in the open - chain fischer…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises one…
Q: A total of 2.5 x 105 cells were harvested from the patient. You need the cells to fill a scaffold…
A: For calculation of volume we need to know the basic formula of l×b×h
Q: Students carry out a laboratory experiment with avidin (a protein in eg white) having a very high…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Q: An infant was admitted to hospital for failure to thrive. It was discovered that the infant lacks…
A: Saturated fatty acids undergo beta oxidation in the mitochondria. A fatty acids with 'n' carbons…
Q: Identify the structures a-d. (a) (b) (c) (d)
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Brown fat is a specialized form of fat that has high levels of mitocho contain uncoupling proteins.…
A: Brown adipose tissue is specialized in burning fat and is responsible for adaptive, non-shivering…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: All of the following classes of enzymes catalyze the Fatty acid synthesis except a. synthetase b.…
A: Triglycerides are storage lipids. These are fatty acid esters of glycerol. Excess of Acetyl CoA…
Q: You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT-5. Assume the annealing primer…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: 1.0 ml of serum albumin (BSA) solution was precisely diluted to 100 ml with a buffer solution, and…
A: The proteins molecules are constituted of twenty naturally occurring amino acids. The aromatic amino…
Step by step
Solved in 3 steps
- What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCAWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
- Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
- he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…does anyone know how to list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC.What does the ob gene code for? How does it work? Is this a gene found only in animals, or do humans have it also?
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
