1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA TAAGCTAG3' 5'GAGATCGATGTCCATCGATCGATCGAATTCGGAGCCAATT DNA 3'CT CTAGCTACAGGTAGCTAGCTAGCTTAAGCCTCGG TTAAATTCGATC 5' mRNA 5' Protein ml

1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA TAAGCTAG3' 5'GAGATCGATGTCCATCGATCGATCGAATTCGGAGCCAATT DNA 3'CT CTAGCTACAGGTAGCTAGCTAGCTTAAGCCTCGG TTAAATTCGATC 5' mRNA 5' Protein ml

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 7TYU: The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively...

See similar textbooks

Similar questions

The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 c) 2 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V d) V and I 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8 d) 13
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).