1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z Suppose the single stand breaks shown in the figure initiated an exchange of segments and branch migration proceeded up to the Y'-Z' region. Following the color-coding and genotypes of the given DNA molecules, a. draw the resulting DNA molecule after branch migration. Do not forget to show the Holliday junction. Z Z'

1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z Suppose the single stand breaks shown in the figure initiated an exchange of segments and branch migration proceeded up to the Y'-Z' region. Following the color-coding and genotypes of the given DNA molecules, a. draw the resulting DNA molecule after branch migration. Do not forget to show the Holliday junction. Z Z'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

1. What can you conclude about the base composition and base distribution of G-C base pairs in the bandicootgenomic DNA from this result? Briefly explain how or why you would reach those conclusions.
1. The simplest mobile elements in bacteria are called ___________________.A. insertion sequencesB. genesC. transposonsD. transposasesE. none of the above 2. ______________ worked in the area of chromosome biology using maize and suggested segments of the chromosome could "jump" to another location.A. Barbara HersheyB. Martha ChaseC. Barbara McClintockD. Rosalind FranklinE. None of the above 3. Transposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a _______________.A. recombinaseB.kinaseC. transposaseD. mobilaseE. none of the above
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
1. The image below shows the base cytosine and a methylated form of cytosine that occurs frequentlyin the human genome. Use your knowledge of DNA structure to answer these questions: a. Does methylation of cytosine affect its ability to base-pair with guanine? Explain. b. Could methylation of cytosine affect the binding of a protein that interacts with a C-G basepair in the major groove? Explain your answer.
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
At a specific area of this chromosome, the sequence of nucleotides below is present where the chain opens to form a replication fork: 3’ C C T A A G C C A T T C G G A 5’ In cells replicating their DNA, the primase enzyme generates a primer from this template sequence, starting at the underlined A (A) of the template. What is the primer sequence (written 5'-->3')? Group of answer choices UCCGAAU ACCGAATCC ATTCGGA UGGCUUAGG UAAGCCU GGAUUCGGU
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
Draw the structure of the double Holliday junctionthat would result from strand invasion by both ends of thebroken duplex into the intact homologous duplex shownin Figure Q5–3. Label the left end of each strand in the Hol-liday junction 5ʹ or 3ʹ so that the relationship to the paren-tal and recombinant duplexes is clear. Indicate how DNAsynthesis would be used to fill in any single-strand gaps inyour double Holliday junction.
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.