49. The "killer" yeast phenotype is caused by A. tyramine production B. production of fusel alcohols C. ethyl acetate production D. hyper-active peptidase E. infection with a virus 50. A killer yeast will kill a competitor by A. preventing budding B. degrading its biofilm C. punching holes in its cell membrane D. Increasing its own ethanol production E. Increasing malic acid conversion to lactate

49. The "killer" yeast phenotype is caused by A. tyramine production B. production of fusel alcohols C. ethyl acetate production D. hyper-active peptidase E. infection with a virus 50. A killer yeast will kill a competitor by A. preventing budding B. degrading its biofilm C. punching holes in its cell membrane D. Increasing its own ethanol production E. Increasing malic acid conversion to lactate

Name: plz answer both to get a like Thanks. 49. The "killer" yeast phenotype
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: plz answer both to get a like Thanks. 49. The "killer" yeast phenotype is caused byA. tyramine production B. production of fusel alcoholsC. ethyl acetate production D. hyper-active peptidase E. infection with a virus50. A killer yeast will kill a com

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 6QP: Recently, scientists discovered that a rare disorder called polkadotism is caused by a bacterial...

See similar textbooks

Similar questions

Last week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to temperature. SSA1 can be said to display what? a. Antagonistic hypertrophy b. Agonistic pleiotropy c. Agonistic hypertrophy d. Antagonistic pleiotropy e. Reductive pleiotropy f. Modular pleiotropy
What will this yeast strain do more of, compared to a normal strain? A. electron transport B. carbon dioxide production C. fermentation D. ATP synthesis
Recently, scientists discovered that a rare disorder called polkadotism is caused by a bacterial strain, polkadotiae. Mice injected with this strain (P) develop polka dots on their skin. Heat-killed P bacteria and live D bacteria, a nonvirulent strain, do not produce polka dots when injected separately into mice. However, when a mixture of heat-killed P cells and live D cells were injected together, the mice developed polka dots. What process explains this result? Describe what is happening in the mouse to cause this outcome.
_________3. It is microbial organisms that has a gene that makes plants resistant to herbicides. A. Bacillus thuringiensis B. E. coli C. Saccharomycetes cerevisiae
Corn has been genetically engineered to produce the anti-insect poison of a bacterium Bacillus thuringiensis. What is one benefit of this? What are some of the risks?
1. Precise words:Find the nonspecific terms in the following sentences. Replace the nonspecific choices with more preciseterms or phrases (It is not necessary to change the sentence structure).(i) All OVE mutants showed enhanced iP concentrations.(ii) Plants were kept in the cold overnight.(iii) To provide proof of concept for our hypothesis, we studied a virus in its host cell.(iv) The present paper reports on continuing experiments that were performed to clarify thissurprising effect.(v) The first transition state is a little lower in energy than the second transition state. 2. Simple words:Improve the word choice in the following examples by replacing the underlined terms or phrases withsimpler word choices (do not change the sentence structure).(i) These data substantiate our hypothesis.(ii) The difference in our results compared to those of Reuter et al. (1995) can be accounted forby the fact that different conditions were used.(iii) For the purpose of discussing cell migration we…
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises
Each of the ff. involves a disorder in the function of an organelle or other cell structure. Identify the organelle or structure involved and indicate whether it is likely to be underactive or active. a) A maize plant is unable to survive due to recessive lethal gene which causes albinism. b) A baby is placed on a low phenylalanine diet as his newborn screening results revealed that he inherited phenylketonuria. c) A man develops pleiomorphic liposarcoma (rare cancer). The cause of the problem is a hard mass of cells in his right inner thigh that rapidly increased in size in a matter of 2 months. d) A girl suddenly felt weak and manifested cyanide poisoning symptoms after ingesting undercooked cassava which contains cyanoglycosides. e) A male chef learns that he is infertile because his sperm are non-motile. Helping tags: biology, cell biology, cell structure, cell organelle
1. The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which converts superoxide to molecular O2 and H2O2 b.Catalase which converts hydrogen peroxide (H2O2) to water and molecular O2 c.Both A and B d.Neither A nor B 2. Prions have the following characteristics EXCEPT a.Cannot be destroyed by enzymes known to digest DNA or RNA b. Do not have nucleic acid c. Do not have protein molecules d. Tiny infectious molecules sensitive to urea, phenol, and other protein denaturing agents PLEASE ANSWER BOTH QUESTIONS, ASAP Please no need for long explanation
Bacteriophages kill their host quickly by ______ . a. binary fission b. a lytic pathway c. a lysogenic pathway d. transformation
46. Mdm2 its own creator A. Stimulates B. Deregulates C. Destroys D. Transports
54) Model system where the aberrant mRNA surveillance system known as NMD is discovered a) Arabidopsis b.Sacharomyces c.Eschericia d.Caenorhabditis