Q: which of the following events occurs during anaphase B in a mitotic cell a. lengthening of the…
A: Anaphase includes two sub phases and are as follows, Anaphase A and Anaphase B. During anaphase A:…
Q: 15. Ascorbic acid is considered a secondary antioxidant, since its role involves the reduction of…
A: Mechanism of Pro-oxidant activity of ascorbic acid.
Q: You measure the temperature of a pond during all 4 seasons and get the following average…
A: Water of pond holds the oxygen I.e essential for the sustainance of life. Oxygen is usually found in…
Q: What are the advantages and disadvantages of Kato-Katz technique? Briefly explain each.
A: Kato -Katz technique advantage and disadvantages.
Q: Substrate cycling does not violate the laws of thermodynamics in making both directions of a…
A: In the third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate .…
Q: Endocarditis is O an infection of the endocardium the lining of the heart muscle and valves. It can…
A: Introduction:- Epicardium, myocardium, and endocardium are the three layers that make up the heart's…
Q: Which of the following is/are expected challenges in the field of tissue engineering? Creating…
A: Tissue engineering, also referred to as as regenerative medicine refers back to the tries made for…
Q: A transgenic mouse was produced which lacks a protein that is required to assemble tight junctions…
A: Cell junctions These are the connections present between the two cells or the cell and plasma…
Q: Question 5 of 18 When a threshold or a minimum magnitude of voltage fluctuation is reached, Select…
A: The neurons are responsible for generation and transmission of nerve impulses. They contain specific…
Q: 73. Which among the statements below is/are TRUE about potassium? 1- Potassium ions move out from…
A: "Blood" is an extracellular matrix made up of plasma, red blood cells, platelets, and white blood…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: When 12 molecules of glucose enter glycolytic pathway, how much NADH molecules are prdouced?
A: Glycolysis is the process where one mole of glucose is oxidized into two moles of pyruvate and…
Q: ase answer fast and all
A: Answer 22:- TRUE Answer 23:- FALSE, it is Fusion (F) protein. Answer 24:- FALSE, on the mucose of…
Q: n the SIR model, if S is 99 and I is 1 (total population is 100) at the beginning of a disease…
A: The SIR model tracks the quantities of susceptible, infected and recovered people during a…
Q: pregnant women as the parasite can cross the placenta to the fetus
A:
Q: Question 1 Baby Boy jack was born at 29 weeks gestation, his birth weight was 900g. He is now 2…
A: Note - We are supposed to answer three subpart of a question according to our guidelines. Please…
Q: Urgent please The larval stage of dragonflies live in water. The graph below shows the population…
A: Ecology is the study of the interactions between organisms and their surroundings, an ecosystem is…
Q: Given the following DNA sequences for cytochrome c, answer the question below. In one paragraph,…
A: Very closely related species have more amino acid sequence similarities in the same protein. The…
Q: What form(s) of chemical energy are generated during cyclic photo-phosphorylation? 1 NADPH and ATP…
A: Photosynthesis is a metabolic phenomenon in which glucose is synthesized by taking raw material lke…
Q: At metaphase I of meiosis, the two homologous chromosomes of each bivalent are connected to spindle…
A: During metaphase I, homologous pairs move together along the metaphase plate, as kinetochore…
Q: Which models show a 2n=8 cell? Select all that apply.
A:
Q: What is the driving force to separate the sister chromatids during Anaphase A of mitosis? A.…
A: Anaphase It is the fourth phase of mitosis. It is the process by which a parent cell's replicated…
Q: According to an old celebrity rumor, L' nel Ritchie is Khloe Kardashian's dad. If Khloe were type O…
A: Khloe Kardashian is type O blood group, which means she have two alleles of IO (genotype IOIO). Now,…
Q: In a graphing paper, construct age structure diagrams for country A and B using the given data…
A: A population is defined as the total number of people who dwell in a certain area. The population of…
Q: Choose correct answers |Females of Spongy Moth (Lymantria dispar dispar) have no wings. Spongy Moth…
A: 1. False Both male and females have wings 2. False Spongy moth is a highly invasive species. 3. True…
Q: 14. The thin stalk of the stamen 1- Anther Style Stigma 2- 3- Filament
A: Plants are mainly multicellular, predominantly photosynthetic eukaryotes of the kingdom Plantae. The…
Q: 13. What is the male reproductive structure in a flower
A: Flower is the reproductive organ of a flowering plant. It consist of four whorls which are mainly…
Q: 1) Assembling a genome after whole genome shotgun sequencing is substantially complicated by the…
A: The assembly of the genome means the process in which the genes are arranged in a correct order. It…
Q: he lac repressor and the pur repressor are homologous proteins with very similar three-dimensional…
A: Purine repressor (PurR) is a DNA-binding protein that is involved in the transcription process. Its…
Q: Which of the following changes to the microtubule binding protein, Tau, commonly occurs in…
A: Tau is a protein that is known to be associated with the microtubules and helps in the assembly of…
Q: Question:- If transmission rate is 0.7 and recovery rate is 0.3, what is the basic reproductive…
A: The expected number of cases directly generated by one case in a population where all individuals…
Q: Part of the protein-coding region in a gene has the base sequence 3-…
A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…
Q: Discuss how variation in the length of the neck in the giraffe would help a population of giraffe…
A: Introduction Evolution:- It is the change in the characteristics of a species over several…
Q: Describe the ultrastructure of a cillium or flagellum?
A: The cilia and flagella are complex, minute, and similar in structure but vary in their length and…
Q: Misconception: Humans can’t negatively impact ecosystems, because species will just evolve what they…
A: The correction will be .. as it says in the above misconception , natural selection doesn't means…
Q: what is the role of ascorbic acid in photosynthesis of fruits and vegetabl
A: Photosynthesis- It is the process by which plants make their food with the help of sunlight,…
Q: Nematocysts are a.) reproductive cells b.)excretory organs c.) set of muscle cells d.)…
A: Answer (e). Defensive cells
Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…
A: Peptide formed from given mRNA sequences.
Q: How does PC help in the identification of the virus from patients?
A: Many processes used in genetic testing and research, such as the study of ancient DNA samples and…
Q: Choose correct answers Most carabid larvae are fungivores. Scarabaeidae larvae have relatively short…
A: 1. False 3. True 4. False. These larave does not have legs.
Q: Trilobite fOS the P-T extinction. They are not fou 12. Explain one inference you can make about…
A: The fossil records demonstrate the geologic time periods. The image shows the cliff in Palo Duro…
Q: In general, mitosis produces two diploid cells. O True False
A: DISCLAIMER " Since you have asked multiple questions, we will solve the first question for you. If…
Q: communication is one of the most extensively used modes of insect communication. What role do…
A: Insects- These are small animal that has six legs. In other worlds you can says that any of a…
Q: What is inflorescence? What are its two types?
A: * Inflorescence is present in a flowering plant which means a cluster of flowers arranged on a…
Q: Suppose that an arthropod such as a locust or crayfish hasabout 105neurons, a fish 108, and a rat…
A: The number of neurons define the complexity of sensory stimulus an organism can process and…
Q: 13. What is the male reproductive structure in a flower
A: Pistil is the female reproductive part of the plants comprising of stigma, style and ovary. The…
Q: A similar experiment is as follows: 1. Obtain 11 (50-ml capacity) beakers and mark from 1-11. In…
A: Since you have asked multiple questions, we are solving only the table 6.a. according to our…
Q: 18.It stimulates biochemical activities that cause observable physiological responses by organisms.…
A: 18. Hormone A hormone is any member of a class of signaling molecules in multicellular organisms,…
Q: Electrophoretic Methods for Assessing Protein Purit
A: electrophoretic method is widely visualised by biochemists and can provide a general picture of both…
Q: where they experience no predation or competition from native fishes. What kind of growth the…
A: As few individuals of common carp fish is introduced into a lake near ottawa in canada;here they…
Step by step
Solved in 2 steps with 3 images
- The Na'vi of Pandora have a neuronal gene (Na'vi) product that undergoes extensive post-translational processing that produces several protein products with a variety of tissue-specific expression patterns, cellular locations, and functions. Mutations that affect Na'vi expression, sorting, processing and function in specific neurons have been linked to altered skin color and height in Na'vi. Propose a mechanism by which: 1. The protein products of Na'vi can be tissue specific. 2. Na'vi can be processed and targeted to secretory vesicles."Schematic outline of melanogenesis. UVR stimulates the expression of POMC by keratinocytes. The peptide produced is the precursor of the hormone a-MSH, that binds to MC1R in melanocytes. This union leads to an increase in cellular cyclic adenosine monophosphate (cAMP) that in turn leads to increased levels of MITF expression, which upregulates the transcription of TYR, TYRP1 and TYRP2, producing brown-black eumelanin. In the absence of a-MSH, the antagonist ASIP binds to MC1R, and phaeomelanin is synthetized instead. Melanosomes are then transferred to keratinocytes through the dendrites via a shedding vesicle system." Briefly discuss how these several aspects of the molecular and cellular biology of melanin production and melanosome transfer contribute to determine skin color. How would different mutations in the hormonal response to ultraviolet light, the melanin production signal transduction pathways, and melanosome transfer influence skin color, hair color, and eye color? Did…GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
- mRNA expression level is not always a good indicator for protein expression why and what is?Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene.Explain How can you study protein Z in these cells? (no need for these qustions)Explain how can you study protein Z components? (needed)Proteins that are retained in the ER have a KDEL sequence at their C-terminus. To test the idea that KDEL is both necessary and sufficient for retention in the ER, two experiments were performed. First, it was deleted from protein disulfide isomerase (PDI), and this form of PDI got secreted. Second, it was attached to a peptide growth hormone, which is normally secreted from the cell. This modified peptide still got secreted. Which interpretation does this support? The data do not allow for an interpretation, additional experiments are needed. KDEL is sufficient but not necessary for ER retention. KDEL is both necessary and sufficient for ER retention. KDEL is necessary but not sufficient for ER retention.
- The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?mTOR must be tightly regulated because it controls both transcription and translation. true or false. explain whyPredict the location(s) (intracellular or extracelular) and a brief description of WHY based on your knowledge of the transport processes in the following constructs. Assume a start codon is present and include any proteolytic processing that would be likely. 1. A PTS1 C-term peroxisomal targeting seq added to C term of a normally secreted protein with usual N -terminal signal sequence 2. Adding of N-terminal mitochondrial targeting sequence to protein with internal nuclear localization seq. 3. Adding N-terminal signal sequence of secreted protein to N-terminus a mitochondria matrix protein precursor with mitochondrial targeting sequence still present
- I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank youHow alternative splicing partially explainswhy the diversity of human proteins vastlyexceeds the number of human genes