Answered: Explain how can you study protein Z…

Science

Biology

Explain how can you study protein Z components? (needed)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 13QP: Suppose that in the formation of phenylalanine hydroxylase mRNA, the exons of the pre-mRNA fail to...

See similar textbooks

Related questions

Q: Phorbol esters have been observed to induce the transcription of AP-1–influenced genes. Explain how…

A: Signal transduction is a process in which signals from the extracellular level enter the…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: How does an intracellular receptor regulate gene expression in the cell? Describe briefly what…

A: Intracellular receptors found inside the cell. Typically in the nucleus and cytoplasm. They are…

Q: Would the mutation in the blue protein be considered a enhancer or suppressor of the original…

A: Mutation is an event that is responsible for the change in the nucleotide sequence in the DNA of an…

Q: Understanding why these receptors are present when they are not supposed to be is important in…

A: When there is methylation at the cytosines present in promoter the genes are silenced as they blocks…

Q: You are studying a protein called Fatransformase that affects the saturation of phospholipds in…

A: Genes are present in DNA which undergoes transcription and translation to make a protein. This is…

Q: As a cell makes the transition from normal to malignant growth, there is increased dependency on…

A: Km value is numerically equal to substrate concentration at which half of the enzyme molecules are…

Q: Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are…

A: The antisense RNA, transcriptional repressor proteins, and feedback inhibition are different…

Q: These are protein regulators in ER which control the proper folding of newly synthesized or…

A: Endoplasmic Reticulum is a network of tubules present in the cytoplasm. It is present in two forms-…

Q: Proteins that are retained in the ER have a KDEL sequence at their C-terminus. To test the idea…

A: Protein disulfide isomerase,, is an enzyme in the endoplasmic reticulum (ER) in eukaryotes that…

Q: How many ATP and GTP molecules would be hydrolyzed in the synthesis of a 125 amino acid protein?…

A: ATP and GTP provide signals to drive many cellular functions.

Q: Suppose that you have cancer cell line X was treated with drug Y to increase the expression levels…

A: Given, X is a cancer cell line which was treated with a drug Y. It resulted in the increase of…

Q: Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes…

A: Cancer Cancer if a kind of disorder which caused by several means like drug, radiation, malfunction…

Q: Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: Suppose that you have cancer cell line X was treated with drug Y to increase the expression levels…

A: The genes that suppress tumors are ordinary genes, which delay cell division, fix DNA errors or tell…

Q: Prostate cells usually require testosterone and other androgens to survive. But some prostate cancer…

A: Prostate cells usually require testosterone and other androgens to survive. But some prostate cancer…

Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…

A: The construction of this question gives us an information about the nature of protein P, P when…

Q: Please explain correct answer

A: Apoptosis is an energy dependent genetically programmed process which occurs during embryogenesis,…

Q: hat is the nature and likely location(s) of a mutant that would, 1)allow constitutive expression of…

A: The lac operon is an operon or group of genes with a single promoter (transcribed as a single mRNA).…

Q: The mechanism by which lactose controls the lac of A) O Catabolite repression B) O DNA polymerase C)…

A: Operons are studied to understand the regulation of gene expression. It is studied under the domain…

Q: Assume a bacterial cell has a mutation in the gene that codes for CRP, such that the mutant CRP-CAMP…

A: An operon is a set of structural genes regulated by a common promoter in bacteria.

Q: Based on the labels you should be able to recognize the characteristic structure depicted below and…

A: Introduction The Process Of Turning Nucleic Acid Information Into Amino Acids Is Known As…

Q: [GAINI- is a protein coding gene that regulates cardiomyocyte metabolism in patients with heart…

A: Cardiovascular refers to the circulatory system. The circulatory system, which includes the heart…

Q: Suppose that you have cancer cell line X was treated with drug Y to increase the expression levels…

A: Cancer cell lines are usually generated by isolating them from the cancer tissue itself. These cells…

Q: propose three festurs of a model to connect the genetic mutation you oredicted with the activity of…

A: Introduction: An adjustment in a sequence of DNA is known as mutation. Mutations can result from DNA…

Q: Explain How can you study protein Z in these cells? (needed)

A: The tumor suppressor gene directs the production of a protein that regulates cell growth during cell…

Q: In the case of the insulin receptor (IR), the RNA-binding protein RBP described in lecture in muscle…

A: RNA binding proteins bids to mRNA based on structure or sequence and form ribonucleoprotein…

Q: How would you identify patients whose tumor cells are particularly likely to have a somatic mutation…

A: Somatic mutation takes place in all types of cells in the body except the germ cells. Therefore…

Q: You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a…

A: In case of third experiment, both SRP (signal recognition particle) and endoplasmic reticulum…

Q: Rare gain-of-function mutations cause increased _______________production, synthesis of an altered…

A: Mutation is the change in an organism’s DNA sequence. The change may occur in the sequence of bases…

Q: TGF-β1 is a protein that affects cell growth and differentiation. Scientists conducted an experiment…

A: Gene expression is the production of RNA (mRNA ) from the DNA by the process of transcription. By…

Q: In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor…

A: Mutation is a permanent change in the genetic material (the genome) of a cell of a live creature or…

Q: Under normal physiological conditions, proto-oncogenes and tumor suppressors help control cell…

A: A significant contrast among the oncogenes and tumor suppressor genes is that oncogenes result from…

Q: The three amino acids "DRY" in loop I2 are required for protein targeting. What is the name of this…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a…

A: Molecular biology is an emerging field which focuses on the molecular basis of all biological…

Q: Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations…

A: The lex A gene encodes a repressor protein and is involved in controlling the DNA repair, inhibition…

Q: You know that the mRNA and protein produced by aparticular gene are present in brain, liver, and…

A: The mRNA (messenger Ribonucleic acid) and protein are present in all the three cell types; that is…

Q: la) The MRNA transcript encoded by a gene called TLR4 has 3 EJCS (Exon Junction Complexes) bound to…

A: A gene is expressed through the processes of transcription and translation and involve many…

Q: Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose…

A: EMSA electrophoretic mobility shift assays is an in-vitro method of analysis.

Q: Gene expression can be affected by all of these EXCEPT: - Considering chromosomes -Adding mote…

A: Gene expression is the process by which information from a gene is used in the synthesis of a…

Q: how would the disruption of the Rb family of proteins lead to cancer? Describe the possible…

A: Please follow step 2 for detailed explanation.

Q: You wish to find the cis-acting regulatory DNA elements responsible for the transcriptional…

A: One or more trans-acting factors frequently bind to cis-regulatory components. To conclude,…

Q: Provide one mechanism by which changes in mRNA levels are not always matched by changes in the…

A: Post-transcriptional regulation is the mechanisms by which cell prevents formation of any wrong…

Q: The human insulin gene contains a number of sequences that are removed in the processing of the mRNA…

A: Insulin is a hormone released by beta cells of the islets of Langerhans of the pancreas. This…

Q: membrane-associated protein kinase has the sequence -GMCLVS at its C-terminus, which has been shown…

A: Mutagenesis is the process by which the change in the DNA of an organism results in the mutation of…

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

Suppose that you have cancer cell line X was treated with drug Y to
increase the expression levels of protein Z which is a tumor
suppressor gene.

Explain How can you study protein Z in these cells? (no need for these qustions)

Explain how can you study protein Z components? (needed)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene. (no need for this qustion)Explain How can you study protein Z in these cells? (needed)
Both ADA-SCID and type I diabetes are diseases based on lack of a particular protein. Why has the pioneering work on gene therapy focused on SCID instead of on diabetes?
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS- KAPTKKPKATPVKKAKKKLAATPKKAKKPKTVKAPVKASKPKKAKPVK” Please propose pathway the degradation of this protein.
How many ATP and GTP molecules would be hydrolyzed in the synthesis of a 125 amino acid protein? Explain why this is a good argument for careful regulation of gene expression (especially considering that most proteins are larger than 125 amino acids).
TPA protein function. Use at least two sentences to describe the function of the TPA protein.
Describe the relationship between protein expression level and protein activity level. How could a mutation alter the activity level and not the expression level.
These are protein regulators in ER which control the proper folding of newly synthesized or misfolded proteins
mTOR must be tightly regulated because it controls both transcription and translation. true or false. explain why
The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?
Cancer-promoting mutations are likely to have different effects on the activity of proteins encoded byproto-oncogenes than they do on proteins encodedby tumor-suppressor genes. Explain.
Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)