1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this DNA? 3. What is the sequence of the polypeptide that will be produced from this gene?
Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: What are the forces that stabilizedouble stranded DNA?
A: As DNA is i double helix structure having 2 complimentary strands, it is necessary to maintain this…
Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…
Q: 1. Define the following terms DNA RNA Replication Translation…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: What is the nature of genetic mutation of DNA repair proteins?
A: DNA repair proteins are those that are involved in repair of damaged or mutated DNA. Mutations can…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'
A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…
A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…
Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…
A: According to the question, we have seen a diagram, where we have to transcribe the two new…
Q: 3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…
A: DNA repair is the correction of incorrect nucleotides or missing nucleotides in a single strand or…
Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions
A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:…
Q: 1. How does the DNA structure reflect its functions? 2. What are the important features of the DNA…
A: The DNA molecule is made up of two strands that form a double helix shape as they coil around one…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: 3. In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…
A: Deoxyribonucleic acid (DNA) contains 2 segments referred to as coding and template strand. These…
Q: 1. Describe at least four ways in which transcription is different from DNA replication.
A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…
Q: Why aren't ssb proteins necessary in transcription?
A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G…
A:
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the…
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…
Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…
A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 8 How natural processes can change the information stored in DNA?
A: Genetic information is stored in the chemical structure of DNA molecule. DNA molecule contains two…
Q: Define transcription and translation. Which process occurs first to make protein from DNA? 2. In…
A: Transcription is the process where RNA is synthesized from DNA. Translation is the process where…
Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…
A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…
Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…
A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…
Q: 4. Why do the dideoxynucleotides stop DNA extension?
A: The sequences of nucleotides on the DNA strand (dNTPs) constitute the genetic code or genome. The…
Q: Describe or explain how the presence of a thymine dimer in DNA being used as the template strand…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…
A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…
Q: 3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b)…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA from nucleotide…
Q: What is the purpose of cell dissolution? 2. What is the purpose of DNA separation? 3. What is the…
A: Cell lysis : The method in which the cell membrane is broken down to release the inter-cellular…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 3. Give the different hydrolytic products of : a. DNA b. RNA
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…
A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…
Q: 1. Why is the specific base pairing is essential to the processes of transcription and translation?…
A: Introduction Translation:- It is the process in which a cell makes proteins using the genetic…
Q: 6) How do the two complementary nucleotide chains of the DNA facilitate the replication process of…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: 4. How is replication different from transcription in terms of product? 5. What do you call each…
A: DNA is the deoxyribonucleic acid which contains the genetic coding of an individual.
Q: 1. Explain how DNA encodes genetic information. 2. Explain the role of complementary base pairing in…
A: Explain how DNA encodes genetic information The arrangement, or sequence, of the nucleotides along…
Q: Explain the concept of central dogma of biology
A: The ultimate goal of all living beings is to pass on their genetic information. This genetic…
Q: Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences…
A: Enzymes are the protein which acts as catalyst in the chemical reactions. Enzymes neither takes part…
Q: Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to…
A: DNA polymerase is the enzyme required for replication of DNA and RNA polymerase is the enzyme…
Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…
A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…
Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…
A:
pls answer
Step by step
Solved in 3 steps
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
- The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…To test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T G G C A T A A C A C T 5' Note: Prepare the partner strand of the given DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
- The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
- . An RNA polymerase is transcribing a segment of DNA that contains the following sequence: 5’-GTAACGGATC-3’ 3’-CATTGCCTAC-5’ If the polymerase transcribes this sequence from left-to-right, what will the sequence of the RNA be? What will the RNA sequence be if the polymerase transcribes right-to-left?You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′