Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. For each mutated DNA sequence, translate and record the resulting amino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Amino acid sequence of peptide: Type of mutation:

Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. For each mutated DNA sequence, translate and record the resulting amino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’ Amino acid sequence of peptide: Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Amino acid sequence of peptide: Type of mutation:

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
Below is a DNA strand. We will call this the original strand, and you will transcribe and translate it first. Each question thereafter is a variation of the original strand with a mutation. Transcribe and translate the DNA strand for each number, and identify the type of mutation. It is important to determine where the change in DNA occurred in each mutated strand to help you identify the mutation type. Original: DNA TAC CCA GAG ATG CAT mRNA Amino Acid Mutation 1 DNA TAC CAA GAG ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 2 DNA TAC CCA GAT ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 3 DNA TAC CCA GAG ATT CAT mRNA Amino Acid…
Below is a DNA strand. We will call this the original strand, and you will transcribe and translate it first. Each question thereafter is a variation of the original strand with a mutation. Transcribe and translate the DNA strand for each number, and identify the type of mutation. It is important to determine where the change in DNA occurred in each mutated strand to help you identify the mutation type. Original: DNA TAC CCA GAG ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 2 DNA TAC CCA GAT ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 3 DNA TAC CCA GAG ATT CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 4 DNA TAC CAG AGA TGC AT… mRNA…
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′
Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA Mutated – CCU-GAU-GAG-UGA* Please choose one correct answer only A. Missense B. Nonsense C. Silent D. Frameshift
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly