Explain the concept of central dogma of biology

Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 1. Which sequence has a purine base at the 3' end? A) TCTAG B) AUCCT C) GUGCCU D) CCTTC 2. Select a…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are the nucleic acids which are…

Q: discuss the effect of temperature on the viscosity of the liquid

A: Viscosity is a measure of resistance of a fluid to flow. It is caused by friction in a fluid.

Q: Which of the following is NOT correct regarding DNA and RNA synthesis? Select one: a. The overall…

A: Replication is the process by which, DNA is copied. Where transcription is the process by which DNA…

Q: Discuss the similarities and differences between RNA polymerase and DNA polymerase

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. Nucleotides are the…

Q: 1. Define the following terms DNA RNA Replication Translation…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: DNA REPLICATION

A: DNA refers to Deoxyribonucleic acid. It is genetic material of almost all the organisms, except few…

Q: Explain the following statement : a) initiation of bacteriall DNA replication is an energy…

A: Bacterial DNA replication also occurs in 5ˊ-3ˊdirection like eukaryotic replication. Both bacteria…

Q: 115. E.coli has only 4.6 ×10° base pairs and completes the process of replication within 18 minutes;…

A: The answer will be 2000 if the process of replication occurs within 38 minutes. So, the answer is…

Q: 2. What is the function of each of the replication enzymes listed below? a. DNA polymerase III b.…

A: The DNA replicates itself multiple times during the replication process. It is a biological…

Q: utline the four broad classes of chemical damage to DNA.

A: Epigenetic mechanisms are described in detail. Multiple biological processes that affect epigenetic…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…

Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…

A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…

Q: 1. Determine what amino acid will be formed from the given  DNA strand below:…

A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…

Q: Explain this picture. Topic central dogma under DNA replication

A: Semiconservative Replication System:It is a most accepted model. It produces two DNA helices in…

Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…

A: Nucleic acid is chemically different than protein and carbohydrate . This difference  helps in…

Q: DNA is directly involved as a template in the following processes, except _________. a. mutation b.…

A: Deoxyribonucleic acid, or DNA. It includes units known as nucleotides, which are biological building…

Q: Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork

A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…

Q: 3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b)…

A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA from nucleotide…

Q: Which of following statements describes a difference between replication of DNA and transcription of…

A: Replication is the process of copying of DNA to make identical copies of dna molecules. This occurs…

Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…

A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.

A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…

Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: 3. Give the different hydrolytic products of : a. DNA b. RNA

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: Mention and explain 4 characteristics of the Structure of DNA.

A: DNA- Deoxyribose Nucleic Acid

Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: What is unique about the structure of the DNA molecule? A It is a carbohydrate. B It can move in and…

A: The correct option is D it can serve as its own template for its replication  explanation:- The…

Q: Explain the central dogma - how DNA, RNA, and proteins are related.

A: The gene is the sequence of nucleotides that require certain processes to express it into protein.…

Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is present in the…

Q: Write down the major differences between DNA and RNA.keeping in mind the concept of "central dogma".…

A: Nucleic acids are the one of the biomolecules which are the main information carrying molecules of…

Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…

A: CENTRAL DOGMA CONCEPTS                           DNA–>RNA–>protein

Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Origins of replication   A contain a binding site for an initiator protein   B contain an AT rich…

A: The origin of replication is a particular sequence in a DNA at which the process of replication is…

Q: The extraction of DNA is a common procedure in biotechnology research laboratories. Research the…

A: Common DNA extraction methods Different extraction methods result in different yields and purity of…

Q: How are nucleotides formed?

A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…

Q: Describe each hypothesis for DNA replication A.) Conservative B.) Semiconservative C.) Dispersive

A: DNA is the genetic material of the body that stores all the genetic information and DNA replication…

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

A:

Q: Which of the following statements about the processes of the central dogma is/are incorrect? I.…

A:

Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…

A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…

Q: 21. DNA replication is A. Semiconservation B. Conservative C. Dispersive D. Heteroconservative 22.…

A: DNA is the genetic material of most of the living organisms. Any substances which are capable of…

Q: 9. a. Describe the experiment that determined DNA is the genetic material. b. Describe the…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…

A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides  are made up…

Q: 6. What are the sides of the DNA ladder made of? a. b.

A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…

Q: 1. Give the different hydrolytic products of : a DNA b. RNA 2. Enumerate the biological functions of…

A: The biological macromolecules that constitute a living system are : Nucleic acid (DNA and RNA),…

Q: Define the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. replicon

A: DNA represents the genome of a variety of organisms and can exist in single-stranded or double…

Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is   DNA Polymerase…

A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…

Q: . Describe and list the steps involved in DNA replication. 2.

A: DNA is a molecule made up of two polynucleotide chains wrapped around each other to form a…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.