Hi please can I have the sol MTN13:308%Google Drive - online backupOpen in the Drive appОPENComplete the following problems.Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecularbiology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequencesby analyzing the fragments generated upon restriction digest, as in the example shown in Figure1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjectedthe pMBBS plasmid to complete digestion by different combinations of three REs (ECORI, BamHI,and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can gleanfrom this gel, answer the questions that follow.EcoRIBamHIXholDNAsizeladder3000 bp2500 bp2000 bp1500 bp1200 bp1000 bp900 bp800 bp700 bp600 bp500 bp400 bp300 bp200 bp100 bpVC 100bp Plus DNA ladderfrom Vivantis Technologies*The same total amount of DNA was loaded in each lane.1. What is the total size of the PMBBS plasmid in bp?Answer:bp2. How many cut sites on the PMBBS plasmid does each RE have?EcoRI:BamHI:XhoI:3. If the pMBBS plasmid were digested with all three REs together, how many fragments wouldbe observed, and what would be the sizes (in bp) of these fragments?Number of fragments:Sizes:AAA drive.google.com+|| MTN13:308% DGoogle Drive - online backupOpen in the Drive appОPEN4. Draw the actual map of the pMBBS plasmid, following the style of the sample map shown inFigure 1. Make sure you show the following information: (1) relative locations of the RE sites; (2)size in base pairs of the segments of DNA between sites. (The map need not be drawn to scale.)Answer: (provide a drawing)AAA drive.google.com

As per the guidelines, we are supposed to answer only three subparts. Kindly repost the question…

1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the pMBBS plasmid does each RE have? EcoRI: BamHI: XhoI: 3. If the PMBBS plasmid were digested with all three REs together, how many fragments would be observed, and what would be the sizes (in bp) of these fragments? Number of fragments: Sizes:

1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the pMBBS plasmid does each RE have? EcoRI: BamHI: XhoI: 3. If the PMBBS plasmid were digested with all three REs together, how many fragments would be observed, and what would be the sizes (in bp) of these fragments? Number of fragments: Sizes:

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 23QP

See similar textbooks

Similar questions

Preparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?
Molecules of DNA Polymerase III per Cell vs. Growth Rate It is estimated that there are 40 molecules of DNA polymerase III per E. coli cell, is it likely that the growth rate of E. coli is limited by DNA polymerase III availability?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Plasmid Mapping (what is it? why is it important?).
Do virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?
Strand directed mismatch repair corrects copying erros based on Which of the following apply to the statement above, there maybe more than one. a. the strand containg breaks in the sugar backbone of the replicated DNA b. structurral instabilities created between oncorrect base pairing and associated histone proteins c. mutations that are evolutionary beneficial to an organims and recults in these areas of the genetic code to be turned off d. methylation of adenosine in GATC sequences during bacterial DNA replication e. repair sequence motifs that attract DNA polymerase gamma