10) Determine bending rigidity of double stranded DNA molecule with persistence length of 45 nm (80% TA, 20% GC pairing).
Q: Why do some enzymes require covalent modifications, such as phosphorylation or glycosylation?…
A: Introduction: Covalent modification involves the addition of a functional group onto the enzymes by…
Q: Amino Acid Biosynthesis Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a…
A: The first Roundup Ready crops were genetically modified soybeans developed in 1996, that were…
Q: 1. Researchers isolated a monomeric protein from platelets that has 2 binding sites (A and B) for…
A: It is said that there are 2 binding sites for the ligand (the ligand here is ADP) in the protein .…
Q: 4. Describe the role of His in the catalytic mechanism shown.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Structural and functional features of the lysosomes include I. internal pH is higher than the…
A: Lysosomes are cell organelles that help in cellular digestion of foreign particles, food particles…
Q: The structure shown is an example of a type of macromolecule (carbohydrate, lipid, protein, or…
A: The biological macromolecules that constitute a cell are proteins, nucleic acids, lipids and…
Q: he following is a coenzyme or cofactor involved in enzymatic reaction. identify the biochemical role…
A: A coenzyme is an organic non-protein compound that binds with an enzyme and assists in enzyme…
Q: How do R groups constrain the potential conformations of a protein?
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Why doesn't the net reaction for the citric acid cycle have intermediates (citrate, isocitrate,…
A: Citric acid cycle is an amphibolic pathway that completely oxidizes the acetyl CoA obtained through…
Q: The purpose of the progress curve is to determine if an enzymatic reaction rate remains constant for…
A: Progress curve is the measure of enzymatic velocity in a reaction. Velocity is given by the rate of…
Q: When performing cloning experiments, it is not always necessary to treat sources of DNA with the…
A: Isoschizomers are enzymes that can share the same recognition site in restriction digestions.
Q: Using proper convention, provide the amino acid sequence for the following protein. _8_#_H²-8-8° CH3…
A: There are twenty standard amino acids that makeup all the peptides and proteins inside the cell.…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Q: After you collect the reaction data, at time O the positive control absorbance is 0.92 and after 24…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: A/client plans to go foreah10-mile rum, but they become fatigued aftein mites, so they stop: What is…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Which of the following is a type of irreversible enzyme inhibitor A) Mechanism-based (suicide)…
A:
Q: Which statements below are false? ) (a) Antiparallel ß sheets are more common in proteins than…
A: Beta sheets are one of the most prominent secondary structures seen in proteins. Here multiple beta…
Q: In early studies of cultured cells, a respi- ration-deficient mutant of Chinese hamster fibroblasts…
A: Dehydrogenases are a group of enzymes with the ability to extract high energy electrons and also…
Q: 2. After conducting enzyme activity assays with one enzyme and various substrates, you generate the…
A: Enzyme efficiency can be best determined by a factor called catalytic efficiency, expressed as…
Q: Which of the following peptides is most likely to serve as a signal sequence in human tissues a.)…
A: Peptides are polymers of amino acid residues linked via a peptide bond. Amino acids are…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: Explain why quaternary structure is necessary for cooperativity and allosteric regulation. Use…
A: The proteins with two or more polypeptides are called oligomeric proteins and possess a quaternary…
Q: Define optimum pH and temperature of an enzyme. 2. How do changes in pH and temperature affect the…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: Why is the binding of oxygen to hemoglobin cooperative while the binding of oxygen to myoglobin is…
A: Hemoglobin has 4 subunits, 2 alpha subunits, and 2 beta subunits. These 4 subunits collectively make…
Q: 7. Imagine you're purifying a protein with a pl of 6.5 that has a 6-Histidine tag from E. coli…
A: Ni-NTA agarose is an affinity chromatography matrix that is used for the purification of recombinant…
Q: The dissociation of lactic acid to lactate is shown in the reaction. Lactic acid has a pKa of 3.86.…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers…
A: The DNA replication is the process of producing two identical copies of DNA from one original double…
Q: The structures are tautomers of nucleotide bases. Identify each base. OH Base: OH ☆ Base: Base: "OH…
A: Nucleic acids are composed of nucleotides (sugar, nitrogenous base & phosphate group). Nucleic…
Q: Explain how gluconeogenesis ang glucogenolysis are regulated to maintain blood glucose levels during…
A: Gluconeogenesis is the process of transformation of non-carbohydrate substrates ( lactate, amino…
Q: Identify the following structures in a DNA molecule:
A: The four types of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: Consider the reaction: H H SCOA a. What kind of reaction is being performed here? b. What enzyme…
A: Fatty acid oxidation occurs on the outer mitochondrial membrane. The fatty acids must be activated…
Q: Translate the first 10 amino acids into RNA code Explain where this process occurs in the cell…
A: Transcription is the process by which a RNA strand is synthesized complimentary to a DNA template.…
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: 1. What is the isoelectric point (pI) of lysine which has pKa values of 2.1 for the α carboxyl…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: Give an example of how Transamination takes place by a chemical reaction.
A: In transamination reaction, amino group is transferred from a donor substrate to an acceptor alpha…
Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…
A: The process of gene expression requires two steps: transcription and translation. Translation is the…
Q: Which of the choices are types of posttranslational modifications a newly synth choices that apply.…
A: Posttranslational modifications are the amino acid side chain modification in some proteins…
Q: Identify the enzyme involved in this reaction from the Pentose Phosphate Pathway. NADP+ OH -H #V₂ H.…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: Answer in brief sentences in your own words please thank you! 1. Soon after the bolus reaches the…
A: Starch is a complex carbohydrate. Starch digestion starts in the mouth but occurs mostly in the…
Q: Choose (increase or decrease) what will happen to the activity of the given enzyme or the rate of…
A: The phosphofructokinase-I enzyme is involved in glycolysis. Pyruvate dehydrogenase catalyzes the…
Q: Signaling by tyrosine kinase receptors is generally associated with all of the following except: A)…
A: In contrast to G protein-coupled receptors where the cytosolic domain of the receptor is close to…
Q: Write a scheme for the formation of ribose-3-monophosphate. Biological role of the formed compound.
A: Ribose 5-phosphate is the intermediate byproduct of pentose phosphate pathway (PPP). It is comprised…
Q: COPII-coated vesicles bud out of the TGN to transport proteins to the lysosomes. True False
A: COP II coat proteins direct protein and membrane trafficking in between early compartments of the…
Q: If glucose labeled with 14C in C-3 were metabolized by glycolysis, pyruvate would be labeled in: a.…
A: Glycolysis is the metabolic pathway by which 6 carbon glucose is converted into 3 carbon pyruvate in…
Q: What term best describes the isomeric relationship between alpha-D- glucopyranose and…
A: Introduction Carbohydrate is one of the biomolecules in our body. It is made up of carbon, hydrogen…
Q: The net ATP produced during a β-oxidation process is always less than two ATP because An ATP is…
A: Beta oxidation is a catabolic process by which fatty acid molecules are broken down in the…
Q: [1,6-(C-14)-2,5-(C-13)]glucose Trace the course of through glycolysis and the TCA cycle. You need…
A: Carbon tracing is the method by which we trace the path taken by each carbon atom in a substrate, as…
Q: Discuss the principles of Thiobarbituric reactive species (BARS) assay
A: Within a cell, reactive oxygen species (ROS) such as singlet oxygen, peroxides etc are produced as a…
Q: What is the amount of sucrose hydrolyzed (in mg/mL) at optimum temperature ?
A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…
Q: Some characteristics of three proteins are listed in the table below: Protein Molecular Weight (Da)…
A: Gel filtration chromatographic procedure in which the components are separated according to their…
Step by step
Solved in 2 steps
- Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'
- Describe in detail the semi Conservative replication of the DNA double helix structureif the guanine content of certain segment of double-stranded DNA is 22% what is the adenine content?3. Using Chargaff's rule of base pairing determine the amount of guanine in 120 bp long fragment of double strand DNA if there are 45 adenines present.
- Describe qualitatively how the Tm for a double-stranded DNA depends on its nucleotide composition.Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.
- How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair with each other?3' CAG TTA AGG CTC CTA GGT TA 5' Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and with respect to the C-G base pair?Discuss the role of the hydrophobic interactions in stabilizing the following. Q.) Double-stranded DNA