Amino Acid Biosynthesis Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a RoundUp Ready plant, why does it yield more crop per acre, and what are the potential problems with such a strategy with regard to overuse of glyphosate?

Amino Acid Biosynthesis Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a RoundUp Ready plant, why does it yield more crop per acre, and what are the potential problems with such a strategy with regard to overuse of glyphosate?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter35: Plant Nutrition

Section: Chapter Questions

Problem 11TYK: Discuss Concepts If you want to study factors that affect plant nutrition in nature, what would be...

See similar textbooks

Related questions

Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…

A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…

Q: Shown below is a theoretical titration curve of histidine (amino acid). Use the provided titration…

A: Histidine is a basic amino acid with an alpha-carboxylic group, an alpha-amino group, and a…

Q: What is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix,…

A: Electrophoresis means migration of charged particles under the influence of an electric field.…

Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…

A: There are hundreds of different amino acids however only 20 different amino acids participate in…

Q: In the enolase reaction, the Lys 345 and Glu 211 residues participate in the reaction to convert…

A: Enolase is an enzyme which catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate.…

Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…

A: The process of gene expression requires two steps: transcription and translation. Translation is the…

Q: Explain IN DETAIL the process of glycolysis. Include the overall equation, location products,…

A: Introduction Glycolysis is a process by which glucose breaks down to produce pyruvate and energy.…

Q: Plant vacuoles must also maintain an optimum pH for its acid hydrolases. True False

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Their catalytic…

Q: Which technique would best seperate a protein that binds stongly to its substrate?

A: Chromatography is a technique that is used for separation of biological macromolecules form a…

Q: 6-31 You do an enzyme kinetic experiment and calculate a Vmax of 100 If each assay used 0.1 mL of an…

A: Turnover number is the number of substrate molecules transformed into product per minute by one…

Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…

A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…

Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…

A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…

Q: An uncompetitive inhibitor interacts with the enzyme•substrate complex to form a ternary complex…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: 3. Show how the addition of an uncompetitive inhibitor would affect the reaction velocity and…

A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…

Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need…

A: Glycerophospholipids or phospholipids are lipids found in the biological membrane. In phospholipids,…

Q: 16) Region A 17) Region B A) nonpolar B) neither

A: A biological membrane has lipids as an essential component. It includes phospholipids and…

Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…

Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…

A: The question mentions that the geneticist is trying to figure out the number of genes that could be…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…

A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…

Q: A competitive inhibitor interacts with the free enzyme to form an enzyme•inhibitor complex (E•I).…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: Which of the choices are types of posttranslational modifications a newly synth choices that apply.…

A: Posttranslational modifications are the amino acid side chain modification in some proteins…

Q: The metabolic amino acid ornithine is a direct precursor of the polyamine putrescine, shown here. +…

A: Ornithischians is a metabolically active non proteogenic amino acid so that it would not be…

Q: 14. Which of the following is a secondary amide? A. 요 B. NH₂ C. D.

A: Ans: INTRODUCTION The amide group is represented in structural formula by CONH2 .…

Q: Match the following type of vesicles to the direction of transport of materials the vesicles do.…

A: In a cell, transport can be of different types: Endocytosis- Something goes out of cell by…

Q: Cycle of tricarboxylic acids (TCA): • importance for cellular metabolism; • intracellular…

A: It is a step wise cyclic but complete oxidation and decarboxylation of of active acetate group to…

Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…

A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…

Q: Calculate the pI of the peptide KLMRDSP (pKa = 3.5, 3.9, 9.5, 10.0, 12.5).

A: The amino acids contain ionizable groups. The ionic form of these groups depends upon the pH of the…

Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…

A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…

Q: One of the hallmarks of competitive inhibition is that there is constant competition between the…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…

Q: Incubation of the norsolinic acid synthase holo-ACP with malonyl CoA gave malonyl-S-ACP (molecular…

A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…

Q: Wheeler Johnson Principle: Reagents: Reaction: Substance Detected: Murexide Principle: Reagents:…

A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…

Q: A mutation produces a tRNA with a new anticodon. Originally the anticodon was 5'-CCA-3'; the mutant…

A: Sometimes a codon that coded for some amino acid in a mRNA gets mutated to a stop codon. This type…

Q: Does the presence of an uncompetitive inhibitor increase / decrease the apparent affinity of the…

A: Uncompetitive inhibition occurs when an inhibitor binds to an allosteric site of a enzyme, but only…

Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…

A: Proteins are large molecular weight polymers of amino acids with diverse biological functions. Many…

Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…

A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…

Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…

A: Glycolysis: The process through which glucose is broken down to create pyruvate in a cell's…

Q: Nucleic Acid Chromatogram O O Nucleic acid chromatogram with nucleic acids circled in pencil 00

A: Chromatography is a biochemical technique that is used to separate closely related substances from a…

Q: Which of the following interactions would be involved in quaternary structure? hydrogen bonds O…

A: Proteins composed of more than 1 polypeptide chain has Quaternary structure. Each polypeptide chain…

Q: 7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?

A: mRNA is called messenger RNA. mRNA act as a transcript for the synthesis of peptide or proteins.…

Q: Does phosphorylation of an enzyme always increase its catalytic activity ?

A: The phosphorylation of proteins modulates various aspects of their functions. In eukaryotes the…

Q: ATCase catalyzes the conversion of carbamoyl phosphate and aspartate into N-carbamoylaspartate, a…

A: Aspartate carbamoyltransferase is also known as aspartate transcarbamoylase or ATCase. It catalyzed…

Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…

A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…

Q: The enzymatic activity of PFK1 is generally measured by set- ting up a coupled enzyme assay system…

A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…

Q: Look at this molecule and determine the number of molecules created from B-Oxidation: FADH2, NADH +…

A: Beta-oxidation is the process of degradation of fatty acids, in order to synthesize energy during…

Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: Mabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into…

A: In expression and purification of protein from bacterial system, the following steps are performed:…

Q: How much energy is required to synthesize a saturated C12 fatty acid? How does this compare with the…

A: Fatty acid synthesis occurs in the cytosol of all eukaryotic cells except plants (occurs in…

Concept explainers

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.

Question

BIOC 385

Amino Acid Biosynthesis

Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a RoundUp Ready plant, why does it yield more crop per acre, and what are the potential problems with such a strategy with regard to overuse of glyphosate?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

R5 List and briefly discuss the seven factors that should be considered for the development of a novel biosensor.
BIOC 384 Redox Reactions of the Citrate Cycle Q10.3: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a cycle and not a linear pathway with regard to the appearance of radioactivity in the carbon dioxide product.
. WHAT IF? If an element increases the growth rate of aplant, can it be defined as an essential element?
Discuss the suitability of using the PFR as a bioreactor for algae growth.
microbiology practice questions ungrades help!ASAP Overall fermentation involves forming ----- end products from the ----- breakdown of carbohydrates or sugars. Microbial fermentation initially involves ------ pathways, which converts glucose into 2------ molecules. Phenol red or PR is a ------ indicator that turns--------- when PR carbohydrate broth is acidic and ------ when PR carbohydrate broth is alkaline/basic. ------ tubes are placed into PR carbohydrate broth tubes in order to trap gas in the form of a -------.
Discuss key design requirements for photobioreactors. List three different photoreactor designs suitable for an industrial biorefinery, including their key advantages and disadvantages and scale-up issues Max 150 words excluding references
Q24: Industrial Residues Make a study on the processing of residues originating from an industrial process. For this study, choose an industrial process and make a detailed analysis of the residues resulting from each step of this process, and then make the study of how to manage these residues so as not to cause environmental and social damage.
Explain briefly the benefits of using plant cell cultures in alkaloid biosynthesis research.
Relative Concentration of Tea Extracts % Inhibition 0.25 0.974 0.5 0.967 0.75 0.965 1.5 0.959 0.25 0.858 0.5 0.976 0.75 0.982 1.5 0.969 0.25 0.974 plot the graph
Explain growth-cycle phases for a batch cultivation. Does Penicillin production occur in log or stationary phase?
BIOC 385 Pyrimidine Metabolism Q8.2: Explain how an enzyme deficiency in dihydropyrimidine dehydrogenase could lead to severe side effects in a cancer treatment regimen using 5-fluorouracil; what would be the alternative treatment?
wirte out summary on phosphofructokinase (PFK)