17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the template (look at provided nucleotides). Label template and coding/sense (non-template) strand in first column. In the second column, label the 5' and 3' ends of DNA and RNA sequences and the amino (N) and carboxyl (C) ends of the polypeptide. The last four columns represent transcriptional and translational alignments (reading frame). This is from within a coding region so you don't have to find a start codon. Fill in all nucleotides and amino acids using the mRNA code table on the last page. a. On this first grid, assume that the DNA and RNA templates are read left to right. DNA strand DNA strand T GA MRNA codon C A U TRNA anticodon G A polypeptide TRP

17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the template (look at provided nucleotides). Label template and coding/sense (non-template) strand in first column. In the second column, label the 5' and 3' ends of DNA and RNA sequences and the amino (N) and carboxyl (C) ends of the polypeptide. The last four columns represent transcriptional and translational alignments (reading frame). This is from within a coding region so you don't have to find a start codon. Fill in all nucleotides and amino acids using the mRNA code table on the last page. a. On this first grid, assume that the DNA and RNA templates are read left to right. DNA strand DNA strand T GA MRNA codon C A U TRNA anticodon G A polypeptide TRP

Name: 17. Complete the following Central Dogma Grid Puzzles: First determin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand isthe template (look at provided nucleotides). Label template and coding/sense (non-template)strand in first column. In the second column, label the 5' and 3' en

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…
1. Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s 2. Which of the following properties of DNA confers to the presence of 5' phosphate and 3' hydroxyl terminal? a. Double helix b. Polarity c. Complementary base pairing d. Resistance to alkali hydrolysis 3. Which of the following are constant throughout the entire nucleic acid structure? a. Sugar and Phosphate b. A-T + G-C c. A-U + G-C d. Deoxyribose and Ribose
Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.