1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 5 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and once developed, the sequence can be read. On the basis of what characteristic is DNA separated on a gel? b.

1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 5 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and once developed, the sequence can be read. On the basis of what characteristic is DNA separated on a gel? b.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
DNA polymerase III and DNA polymerase I are used in DNA replication in E. coli. What are their roles?
Discuss Concepts During replication, an error uncorrected by proofreading or mismatch repair produces a DNA molecule with a base mismatch at the indicated position: The mismatch results in a mutation. This DNA molecule is received by one of the two daughter cells produced by mitosis. In the next round of replication and division, the mutation appears in only one of the two daughter cells. Develop a hypothesis to explain this observation.
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure of a pyrimidine dimer and explain why the formation of such aberrant structures results in tumor-enabling genomic instability. 2. Use your own words to define ultraviolet light. Include a comparison of naturally-occurring vs artificial UV. What is UV-A? UV-B? UV-C? Which one(s) is (are) the most damaging to DNA? Why? Which one(s) are most likely to lead to a mutation in skin cells? Why? What type of UV light is used in tanning beds?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision repair and base excision repair correct DNA mismatches and damaged bases, but these systems are not considered direct repair. what two general steps do these indirect repair systems have in common?.
5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.