2. An enzyme-catalyzed reaction is carried out at several different substrate concentrations (listed below), either (1) with no inhibitor, or (2) in the presence of an inhibitor, I, at 0.63 g/L. Given the following data, determine: A. what type of inhibitor I is B. the value of K₁ No Inhibitor: With Inhibitor: Substrate Concentration (g/L) 0.86 2.35 3.80 4.90 6.10 18.4 Reaction Velocity (g/L-s) 0.179 0.398 0.567 0.666 0.726 0.950 0.322 0.407 0.443 0.495 0.639 Reaction Velocity (g/L-s) 0.161
Q: 148. A 42-year-old man has persistent swelling and tenderness of his right great toe joint. Turbid…
A: Gout is a type of arthritis that is caused by the buildup of uric acid crystals in the joints. Uric…
Q: What makes RNA a ribozyme? Why are DNA enzymes absent?
A: Enzymes are biomolecules which can catalyze the biochemical reactions. These can be proteins, RNA or…
Q: What are the vitamin derivatives of the following A. Nicotinamide coenzyme B. Flavin coenzyme C.…
A: Vitamins are the organic compounds that are vital for the health of an individual. Vitamins are…
Q: Table 9.2 shows that DGo’ for the aldolase reaction is large, and positive, yet the reaction…
A: The aldolase reaction is a reversible reaction that occurs in the second stage of glycolysis,…
Q: Two common methods of denaturing proteins in the lab are to increase the temperature and/or add…
A: Proteins are biomolecules with diverse biological roles. The function of a protein depends on its…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: 5. Consider the thermodynamics of DNA replication. What are the different thermodynamic parameters…
A: DNA replication is a complex process that involves the unwinding of the double-stranded DNA…
Q: In the traditional alkaline lysis method of Solution 1, what is the purpose of Glucose
A: Alkaline lysis is a method for extracting DNA from cells, particularly from bacterial cells. This…
Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…
A: The structure of biological macromolecules is determined by noncovalent interactions like…
Q: (d) NH + (a) CH₂ CH₂ (b) O-H-- CH H-C CH₂ CH3 CH₂COOH H H CH₁ CH, (c) 5 5 (b) CH₂ CH₂ CH₂ CH CH (d)…
A: Proteins are the macro molecules that show diversity in their structure by possessing four levels of…
Q: Isolate B Isolate A Isolate C Isolate D The purity and concentration of DNA isolate can be evaluated…
A: DNA purification is a process used to isolate DNA from other cellular components. The most common…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Q: You are making 300 mL of MS-agar medium for plant tissue culture. You need 0.4 mg/LBAP and 0.8 mg/L…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Calculate the ATP yield for the full catabolism of a phospholipid containing ethanolamine, C18:3 Δ9,…
A: The catabolism of a phospholipid containing ethanolamine and oleic acid begins with the breakdown of…
Q: 7. Some toxins block the synthesis of mRNA or proteins. Why would this effect be toxic, and how…
A: mRNA is the intermediate molecule between DNA and protein, carrying the genetic information encoded…
Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Match each type of molecule with the corresponding description. Answer choices may be used only…
A: The biological macromolecules can be classified as nucleic acids, proteins, carbohydrates and…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: What are the two monosaccharides that make up this structure? H₂N НО CH3 OH OH H NH₂ N
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Name the most important proteins in plasma and their functions.
A: Plasma contains a complex mixture of proteins, most of which are synthesized in the Liver.
Q: Part 2 Monosaccharides and disaccharides are two of the sub-classes of Carbohydrates. Structure B…
A: The most prevalent category of biological substances is carbohydrates. They consist of starches and…
Q: Prepare a schematic diagram and present it as though it were a Figure in a publication (scientific…
A: Binding of ligand to receptor or protein can be specific and non-specific. For the genuity of the…
Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…
A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…
Q: Which pathways are utilized in order to allow for glucose from glycogen to be converted to ribose…
A: Glycogen is a storage polysaccharide made up of D-glucose residues. When signalled, the cell can…
Q: MATCHING TYPE a. Peroxidase b. Thrombin c. Amylase d. Diastase e. Amylopsin f. Invertase or Sucrase…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: Digestion of proteins in the stomach and intestines. Absorption of digestion products.
A: Proteins are high molecular-weight polymers of amino acid residues. Proteins serve diverse…
Q: describe the principal reactant and products of major steps of glucose oxidation
A: Three distinct metabolic pathways are involved in cellular respiration, which is where glucose…
Q: Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer…
A: DNA replication copies the DNA of the cell. The replication machinery of the cell assembles at the…
Q: Draw a UV-Vis spectrum for each protein (shown in the table below) (A, B, C, and D) from 240 – 480…
A: UV-Vis spectroscopy is a technique that measures the absorption or transmission of ultraviolet and…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: When protein is converted in the body to amino acids, what is the role of water? Only beef proteins…
A: Proteins are essential nutrients that the body needs to function properly. They are important for…
Q: What is the role of protist in metabolism?
A: Metabolism is the process in which food or nutrition is converted into energy by the body of an…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: The central dogma of molecular biology explains how the nucleotide sequence in DNA acts as a…
Q: 5 For the peptide structure in #3, (ASP-ALA-THR-LYS-GLY), use the chart at the end of this HW set…
A: The proteins are composed of twenty naturally occurring amino acids. The amino acids can be…
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenase Outline the…
A: The tricarboxylic acid cycle is the metabolic pathway that generates NADH and FADH2 from the…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Q: ame: ear and Section: Laboratory Manual in Clinical Chemistry II 2023 Group no: Laboratory Report…
A: 1. The acceptable samples for measurement of Sodium and Potassium are typically blood samples, most…
Q: Is vitamin c portly soluble of immediate solubility or highly soluble and what are the mol 1-1
A: Vitamins are small molecule which are required for normal functioning of the body. These molecules…
Q: Evaluate the texture of the two samples from experiment and what do the results in experiment 1 tell…
A: Starch is a complex carbohydrate found in many food products and is a major source of energy for…
Q: The standard Gibbs (free) energy of reaction (A,Gº') of the following reaction is equal to zero (at…
A: Gibbs free energy is the energy released by a reaction when proceeded under constant temperature and…
Q: With fatty infiltration of the liver, the synthesis of phospholipids is disturbed. What is the…
A: Fatty infiltration of the liver, also known as steatosis, occurs when there is an excessive…
Q: Uronic acids are another class compound for carbohydrates. a) Describe the structural difference…
A: Chemically carbohydrates are polyhydroxy acetone or ketones. Uronic acids are also carbohydrates…
Q: Consider the following α helix from myoglobin at pH 7.…
A: Proteins are folded polypeptides. Polypeptides are amino acid polymers linked to each other via a…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Lipids affect your health? why or why not
A: Lipids include fats, oils, waxes, and certain types of steroids. They are an essential component of…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Step by step
Solved in 4 steps with 1 images
- 1. A. Estimate from the graph what the Vmax is for the enzyme without inhibitor present (black circles) and in the presence of the inhibitor (green squares). B. Estimate the Km from the graph without inhibitor present (black circles) and in the presence of the inhibitor (green squares). C. Based on the data, what type of reversible inhibitor do you think was used? Explain your answer.1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the following questions. a. Is it possible for the enzyme to overcome the effect of the inhibitor in question from the chart. Explain. b. What prevents this enzyme from being an even more catalytically efficient enzyme? c. What do single molecule data indicate about the validity of ensemble data?d. What is the reason that humans are insensitive to sulfa drugs?1. Can you describe how electrostatic and steric considerations may lead to preferential stabilization of the transition state at an enzyme active site? 2. What factors are involved in “transition-state complementarity”?
- 1. Provided in the Table below kinetic data for an enzymatic reaction that was carried out in the presence (last two columns) and absence (second column = control) of enzyme inhibitor. Both inhibitors were added in eachreaction at a concentration of 2 mM. The enzyme concentration was similar in all and was approximately 0.001 µM. a. Calculate both Vmax and KM for the control using Lineweaver-Burk curve. b. Provide the type of inhibition for both? c. Find, KI, for the inhibitor binding to the enzyme, for experiments (2) and (3). d. Calculate the reaction Kcat for the Control in experiment (1). e. Draw a velocity versus [S] showing Michaelis-Menten curve for the Control. Clearly show Vmax and KMfor the enzyme.1. Provided in the Table below kinetic data for an enzymatic reaction that was carried out in the presence (last two columns) and absence (second column = control) of enzyme inhibitor. Both inhibitors were added in eachreaction at a concentration of 2 mM. The enzyme concentration was similar in all and was approximately 0.001 µM. a. Calculate both Vmax and KM for the control using Lineweaver-Burk curve. b. Provide the type of inhibition for both? c. Find, KI, for the inhibitor binding to the enzyme, for experiments (2) and (3). d. Calculate the reaction Kcat for the Control in experiment (1). e. Draw a velocity versus [S] showing Michaelis-Menten curve for the Control. Clearly show Vmax and KM for the enzyme.a. What is the Vmax of this enzyme WITHOUT inhibitor? Please show your work. b. What is the Km of this enzyme WITHOUT inhibitor? Please show your work. c. The specificity constant of enzyme X is 8 x 10^7 /(M * seconds) What is the kcat of enzyme X WITHOUT inhibitor? Please show your work d. What was the concentration of enzyme used for measuring the kinetics of enzyme X WITHOUT inhibitor? Please show your work
- For an enzyme-catalyzed reaction, the presence of 5 nM of a reversible inhibitor yields a Vmax value that is 80% of the value in the absence of the inhibitor. The KM value is unchanged. (a) What type of inhibition is likely occurring? (b) What proportion of the enzyme molecules have bound inhibitor? (c) Calculate the inhibition constant.5. For a Michaelis-Menten enzyme, k1 = 5.2 ⅹ 108 M-1 s-1, k-1 = 3.1 ⅹ 104 s-1, and k2 = 3.4 ⅹ 105 s-1. a) Write out the reaction, showing k1, k-1, and k2. Calculate Ks and Km. Does substrate binding approach equilibrium or the steady state? Justify your answer. b) What is kcat for this reaction? Justify your answer. c) Calculate Vmax for the enzyme. The total enzyme concentration is 25 pmol L-1, and each enzyme has two active sites. d) What substrate concentration would be required for the reaction in (c) to reach half of Vmax. Justify your answer mathematically. e) A second Michaelis-Menten enzyme has k1 = 4.2 ⅹ 107 M-1 s-1, k-1 = 6.1 ⅹ 104 s-1, and k2 = 5.3 ⅹ 102 s-1. Which enzyme is most efficient? 6. A pharmaceutical company is trying to develop a1.In a kinetics data set, in case a substrate concentration is given [S] in uM and inhibitor concentration [I] uM, initial velocity (Vo) in umol/min , Km , Vmax, apparent Km, apparent Vmax, and Ki, is there any way of finding Kcat ? 2.Which formula would be used in that case? What would the process be for finding Kcat?
- 1) what is the Vmax of the enzyme WITHOUT inhibitor 2) What is the Km of the enzyme WITHOUT the inhibitor 3) The specificity constant for enzyme X is (8*10^7) /(M*seconds); what is the kcat of the enzyme WITHOUT the inhibitor? 4) what was the concentration of the enzyme used for measuring the kinetics of enzyme X without inhibitor? 5) the dashed line represents enzyme with inhibitor. The concentration of the inhibitor is 5 micromolar. Calculate the equilibrium constant for the inhibitor Please show work and unitsDrug D reversibly binds to enzyme E and inhibits its activity toward substrate S. D binds equally well whether or not S is bound. Sketch a graph of the expected 1/v vs. 1/[S] relationship for: A) The enzyme reacting with S in the absence of drug D, B) The enzyme reacting with S in the presence of a small amount of drug D, and C) The enzyme reacting with S in the presence of a large amount of drug D.List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?2. What is the effect of each of the 4 types of inhibitors on the initial rate of an enzyme catalyzed reaction?3. A potent inhibitor effectively inhibits an enzyme catalyzed reaction. What kind of a Ki value you would expect for a potent inhibitor?4. Considering PNPP → PNP reaction, would you expect to see more intense or pale color for the reaction that contain the inhibitor? Explain.