With fatty infiltration of the liver, the synthesis of phospholipids is disturbed. What is the biochemical basis of the development of such a condition? What are its possible nests? Justify the answer.
Q: What is ATP? Explain in two sentences. 2. How is ATP produce in Glycolysis? Kreb Cycle? Electron…
A: Individual cells release energy through the process of cellular respiration, which involves the…
Q: Which statement about glutamine amidotransferases is FALSE?
A: Glutamine amidotransferases is an enzyme which catalyzes the removal of ammonia group from glutamine…
Q: These enzymes form covalent intermediates A. Papain B. Alkaline phosphatase C. Elastase D. All of…
A: Enzymes are biological catalysts that increases the rate of the reaction. They do so by having a…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: B. Given that five molecules of glucose in eukaryotes underwent full oxidation and entered ETC, how…
A: ATP is the energy currency of the cell also known as 'molecular unit of currency', where it breaks…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: What type of rotational (cyclic) symmetry is apparent in the structure? O Six-fold. O Seven-fold. O…
A: SARS COV-2 belongs to the coronavirus family. It has many proteins that form the complete structure,…
Q: Figure 1 shows the structure of adenine and thymine. (i) (ii) NH H adenine -H =C thymine Figure 1…
A: These are cyclic compounds that contain nitrogen. They can be: Purines: a heterocyclic organic…
Q: Give other chromatographic techniques that can be used for separating non-polar biomolecules, such…
A: Introduction: Chromatography is a method for separating a mixture in the laboratory. The mixture is…
Q: How much 4x loading dye should be added to 11 uL of DNA? Report you answer in units of uL, with one…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Metabolic enzymes are often found in large multi-enzyme complexes. What are the benefits of this…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Substrates bind to the free…
Q: 4. Write the equation for the digestion (hydrolysis) of Phe-Asp-Ala.
A: A tripeptide is made up of three amino acid residues linked via a peptide bond. A peptide bond is…
Q: Explain how glucose can be created from other molecules under starvation conditions.
A: Animals—including humans—use a complex set of hormonal and metabolic adaptations to help them endure…
Q: What chemicals do you think are most harmful to your own health? How are you exposed? How could you…
A: Benzene and other aromatic hydrocarbons, along with heavy metal compounds are one of the the most if…
Q: PJA01 Based on your knowledge of local anesthetic SAR, which of the following drugs will block the…
A: Local anesthetics (LA) are drugs that block the sensation of pain caused by injury or a surgery.…
Q: Describe the role of each of the membrane proteins shown in the picture below. Think about what is…
A: The NADH and FADH2 formed during the glycolysis and TCA cycle transfer electrons to the oxygen. The…
Q: why are fast acting neurotransmitters typically are small molecules?
A: Neurotransmitter is a signaling molecule secreted by neurons to affect another cell across a…
Q: The measurement of alanine aminotransferase activity (reaction rate) usually includes an excess of…
A: If a particular reaction brings about a measurable change (like the generation or consumption of a…
Q: During lactic acid fermentation ___ is converted to ___ thereby oxidizing ___ a. Pyruvate ;lactate…
A: Pyruvate is the end product of glycolysis.NAD+ is needed for production of pyruvate. Under aerobic…
Q: Question 16 Proteins imported into the nucleus are transported via which mechanism? tranlocational…
A: The proteins are constituted of twenty naturally occurring amino acids. The proteins have signal…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: The steroid progesterone has an important role in the female reproductive system. Researchers…
A: Amino acids are organic molecules, which can act as buffers by accepting or donating protons. When…
Q: a. Calculate the physiological DG of the reaction shown below at 37°C, as it occurs in the cytosol…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: Choose below the order of plasma lipoproteins based on the particle size (from smallest to largest):…
A: Lipoproteins are particles made of protein and lipids. They are responsible for carrying cholesterol…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…
A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: What is the total number of H+ transferred from matrix to intermembrane space of the mitochondria by…
A: Complex I, II, and III are the part of the electron transport chain or oxidative phosphorylation.…
Q: 1 what is the common intermediary in the catabolism of carbohydrates, proteins and lipids? 2 What…
A: Metabolism is the process of breakdown of food into energy. Carbohydrates, proteins, and lipids are…
Q: For the electrophoresis at 25°C of two proteins, in a medium with a viscosity of 0.001kg/m-s, the…
A: Electrophoresis is a technique used in biotechnology to separate and analyze biological molecules…
Q: PK 12.5 HO. ОН PK,43 Compound X О
A: The compound X has two distinct stages, corrresponding to deprotonation of two different groups. At…
Q: Converting 1 mol of glucose to 2 mol of oxaloacetate will directly net __ ATP/GTP, __ NADH + H + ,…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: onsider the following tripeptide: Gly—Ala—Val What is the charge of the primary structure of…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: What are the precipitates that were produced during the calcium and chloride ion test when it comes…
A: When it comes to analysis of blood, the calcium ions are determined by addition of oxalate ions that…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: Identify the steps in the glycolytic and citric acid cycle pathways where ATP, GTP, NADH, and FADH2…
A: Introduction Citric acid cycle is also known as tricarboxylic acid (TCA) cycle. It is an important…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True False…
A: The proteins are constituted of twenty naturally occurring amino acids that are linked via peptide…
Q: Explain how energy stored in pyruvate is converted into adenosine triphosphate (ATP) in eukaryotic…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: The peptidyl transferase reaction is an exemplification that the ribosome is a ribozyme. True False
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: A. Dissolution of drugs Tablets Aspirin Bisacodyl Generalizations: Vinegar Solution pH: 2.5 5…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: TRUE OR FALSE 1. The H chain contains one variable and one constant domain. 2. The processes that…
A: Immunoglobulins are 'Y' shaped complex protein molecules. They can be referred to as 'Ig'. They are…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: What is the correct order, from highest content to lowest content, for triacylglycerols in the…
A: Lipoproteins are droplets of fats that are surrounded by a single layer of phospholipid molecules.…
Q: describe the relationship between a proto-oncogene and an oncogene, and explain how one arises from…
A: Proto oncogenes is a normal gene but when mutated it turns into oncogene and gets the potential to…
Q: Which of the following factors favor fatty acid synthesis in liver cells when blood glucose levels…
A: The body utilizes carbohydrates as the primary source of energy. The excess carbohydrates after…
With fatty infiltration of the liver, the synthesis of phospholipids is disturbed. What is the biochemical basis of the development of such a condition? What are its possible nests? Justify the answer.
Step by step
Solved in 2 steps
- Nonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?When the identical subunits of chicken liver fatty acid synthase are dissociated in vitro, all of the activities can be detected in the separated subunits except for the β-ketoacyl synthase reaction and the overall synthesis of palmitate. Explain these observations.What would be the effect on fatty acid synthesis of a mutation in ATPcitrate lyase that reduces the enzyme’s activity? Explain.
- The second step during elongation of fatty acid chain is catalyzed by B-ketoacyl reducatse. In which 2 ways is this reaction different from the corresponding reaction in fatty acid degradation?What is the role of glutathione in protection against damage by reactive peroxides? Why is the pentose phosphate pathway crucial to this protection?What structurtal property of mono- and polyunsaturated fatty acids prevents oxidation of these compounds by the β-oxidation pathway? what additional types of reactions are needed?
- We have stated that fatty acids cannot yield a net gain in carbohydrates in organisms that lack a glyoxalate pathway. Why can odd-chain fatty acids be thought to break this rule to a small extent?Does concentration of xylulose-5-phosphate increase in cells after eating rice? ExplainIf phenylalanine was not an essential amino acid, would diet therapy (the elimination of phenylalanine from the diet) for PKU work? Do not just say yes or no. Give a short explanation for this hypothetical situation.
- Some microorganisms lack DHFR activity, but their thymidylate synthase has an FAD cofactor. What is the function of the FAD?Why is the isomerization of glucose-6-phosphate (G6P) to fructose-6-phosphate (F6P) an important step in glycolysis? How is the isomerization of F6P back into G6P prevented?Which step in lipid metabolism would you expect to be affected by 3,4-dihydroxybutyl-1-phosphonic acid (shown here)? Explain your answer.