2. Determination of the molecular weight of proteins. A student performs a protein separation in the laboratory using electrophoresis. For protein A he obtained a migration distance of 5.8 cm, while for protein B he obtained a migration distance of 9.6 cm. From these results we can say the following Choose one: a. Protein A is positively charged and protein B is negatively charged. b. Protein B is smaller than protein A. C. Protein A is negatively charged and protein B is positively charged. d. Protein A is smaller than protein B.

2. Determination of the molecular weight of proteins. A student performs a protein separation in the laboratory using electrophoresis. For protein A he obtained a migration distance of 5.8 cm, while for protein B he obtained a migration distance of 9.6 cm. From these results we can say the following Choose one: a. Protein A is positively charged and protein B is negatively charged. b. Protein B is smaller than protein A. C. Protein A is negatively charged and protein B is positively charged. d. Protein A is smaller than protein B.

Chemistry: Matter and Change

1st Edition

ISBN:9780078746376

Author:Dinah Zike, Laurel Dingrando, Nicholas Hainen, Cheryl Wistrom

Publisher:Dinah Zike, Laurel Dingrando, Nicholas Hainen, Cheryl Wistrom

Chapter14: Mixtures And Solutions

Section14.1: Types Of Mixtures

Problem 7SSC

See similar textbooks

Similar questions

Chemistry a. Are there methods other than spectrophotometry to determine protein concentration? If there is, please provide an explanation of this method along with its advantages and disadvantages! b. Explain the principle of protein separation by electrophoresis method! c. Can protein electrophoresis method be used to characterize proteins? Please explain why!
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)
Which is correct for polarography? I-polarography is an amperometry method conducted with a dripping Hg electrode. II-The diffusion current in the plateau region of the polarographic wave is proportional to the concentration of the analyte and is used for quantitative analysis. III-The half-wave potential is characteristic of the analyte in a given environment and can be used for qualitative analysis. IV-fresh Hg drops provide reproducible results. V-polarography is primarily used to study oxidations, Hg can be reduced when studying reductions
A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy). When you ran this protein directly on reversed phase-HPLC with UV monitor set at 280 nm, two peaks were resolved. Mass spec determined that the peaks represented Chain A and Chain B, respectively. The peak area is 500,000 for Peak A (Chain A) and 100,000 for Peak B (Chain B). The molecular masses of Chain A and Chain B are 25,000 and 5000, respectively. The extinction coefficients for Chain A and Chain B are 1 mL/mg.cm and 0.5 mL/mg.cm, respectively. Please calculate x/y.
At what distances do hydrogen bonding, hydrophobic interactions and charge transfer interactions act to dominate the interactions between particles when at the isoelectric point? The options are Short range or Long range.
Hello, I would like help with problem 42 in the image attached.
Please create a caption for this table. Solution NaCl Conc. (%) Osmolality (mOsm) % transmittance Absorbance % hemolysis % crenation C distilled 0 0 0.001029 4.987584625 100 0.03354 1 0.177179111 54.61 0.001551 4.809388202 96.42720001 0.05837 2 0.297126222 91.58 0.01012 3.994819487 80.09527231 0.08444 3 0.442542222 136.4 3.849 1.414652089 28.3634704 0.134 4 0.590164444 181.9 64.8 0.188424994 3.777880643 0.2125 5 0.74752 230.4 95.64 0.019360433 0.388172513 0.3368 6 0.89644 276.3 99.56 0.001915112 0.038397585 0.5336 7 1.095648889 337.7 99.98 8.68676E-05 0.001741676 0.9834 8 1.336711111 412 100 0 0 2.1 9 1.755568889 541.1 100 0 0 7.9 10 2.674395556 824.3 100 0 0 57.83 11 4.490211111 1384 100 0 0 99.72
Briefly explain the principle behind the following techniques:(a) ion-exchange chromatography (b) gel filtration chromatography (c) affinity chromatography (d) Use three diagrams to illustrate the separation of three different proteins by thesemethods.
The following data were obtained from a Bradford assay to determine the protein content in a sample: Protein content (μg) Absorbance value 0 0.000 2 0.022 5 0.065 10 0.106 20 0.178 30 0.299 40 0.380 50 0.472 unknown 0.150 a. use excel, another program, or graph paper to produce a calibration curve based on the data. b. Use linear regression (best fit line) to obtain the slope of the line c. Determine the unknown protein content for a sample that shows an absorbance reading of 0.150.
4. Show the step-by-step process. Do not use shortcut methods. Make it as detailed as it can be. ENCODE THE ANSWER.
Which are true for polarography? I Polarography is amperometry conducted with a dropping Hg electrode. II The diffusion current in the plateau region of the polarographic wave is proportional to the concentration of the analyte and is used for quantitative analysis. III The half-wave potential for maximum current is characteristic of a given analyte in a given medium and can be used for qualitative analysis for the analyte. IV Fresh Hg drops give reproducible results. V Polarography is used to primarily to study oxidations Hg may reduce when studying reductions. A.I, III, and IV B. II, III, and V C. I and V D. III, IV, and V E. II, III, and IV
Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.211 and A650=0.086, taking into account the dilution factor as per question 6 (100ul), and the total volume of extract as per question 4 (140ml) . Note your answer to 2 decimal places