Q: OCCURS IN WATER WITI 1. cobalt 2. strontium 3. selenium 4. vanadium
A: Osteoarthritis, also known as degenerative joint disease (DJD), is one of the most common type of…
Q: ROOM FOR VISITORS PHARMACIES - BACTERICIDAL LAMPS, SHIELDED, BECAUSE 1. air in the trading floor has…
A: 1. Air in the trading floor is highly contaminated Indoor health care is important it significantly…
Q: A person with diabetes cannot regulate their blood sugar because their pancreas does not release…
A: If you have diabetes: Your glucose levels will continue to rise after you eat because there's not…
Q: THE LOWEST BACTERIAL AIR POLLUTION ARE EXPOSED 1. Junior nurses 2. pharmacists-technologists 3.…
A: Junior nurses are basically more often exposed to bacterial pollution as they have direct contact…
Q: explain the fluid regulation process in plants.
A: Introduction Osmoregulation is the active control of osmotic pressure in order to keep an organism's…
Q: d.T wave
A: Heart- It is the organ that pump blood through out the body is refers as the heart. it is fist…
Q: To examine: Whether the statement "Action potentials vary in their size" is true or false.
A: During the resting phase, there are more sodium ions outside the cell than inside, whereas the…
Q: SPECIAL METHOD OF WATER TREATMENT AT THE WATER-WIRED STATION 1. boiling 2. softening 3. ozonation 4.…
A: The specialized water treatment usually includes various types of methods such as physical method…
Q: Identify three key ways that TrXG genes promote transcription
A: In the metazoans the TrXg genes help in the regulation of the developmental processes along with the…
Q: THE SPECIFIC POWER BACTERICIDAL LAMP CLOSED TYPE, SHIELDED BE LESS THAN (W / M ') 1. 1 2. 2-2,5 3. 4…
A: UVGI stands for Upper room ultraviolet germicidal irradiation.
Q: The greatest SINGLE threat to most species of plants and animals is: Question 17 options: -…
A: Day by day, environmental pollution and anthropogenic activities degrade the natural resources that…
Q: What, generally, does the forest transition theory predict? Should its predictions bereceived as…
A: The terms 'eco' and 'system' allude to a region of the world and the coordinating entities,…
Q: A 3S Center that is a project of Valenzuela City is what category of health care delivery system? 35…
A: There are three levels of healthcare delivery system. These are: Primary Secondary Tertiary
Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…
A: Introduction DNA:- (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…
Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?
A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…
Q: During aerobic respiration, high energy electrons are taken from glucose and transferred to electron…
A: Cellular respiration takes place either aerobically or anaerobically inside the cells. In case of…
Q: Why is aseptic urine collection important when cultures are ordered? If you counted 20 colonies…
A: Urine collection for the urinary tract infection.
Q: THE MAIN INDICATOR OF ERIDEMIOLOGICAL RELIABILITY IN WATER DISINFECTION IN WATER SUPPLY STATION (AT…
A: Introduction To kill bacteria in drinking water and swimming pools, chlorine and chlorine-based…
Q: Are the Lycaon picture more closely related to the wolf or dog?
A: We are only allowed to do one question. Please repost the undone question again. Thank you for…
Q: Single strand as a template plus 3' end to start DNA synthesis но- Polymerase works, DNA synthesis…
A: Addition of bases to the primer occurs as DNA replication proceeds :-
Q: Label the different parts of stems in the images below: Primary phloem Secondary phloem Vascular…
A: Vascular bundles are organised in a circle all around the pith inside the Dicot Stem. There are four…
Q: Which is NOT true of attachment or adherance? may be due to fimbriae Omay be due to capsules…
A: ANSWER;- only normal microbiota can attach Explain;- Any microbiota with a hook and sucker can…
Q: Complete the table Vitamins (and common names) Importance and reference intakes Source
A: Vitamins are substances that the body needs to grow and develop normally. Vitamins are obtained from…
Q: Urinalysis Lab If you find 20 colonies on a urine plate, you used a 5uL loop, what will be the…
A: In processing urine samples for culture, instead of making dilutions in the traditional way, the…
Q: All of the following may be important keystone species due to their roles as pollinators EXCEPT:…
A: Keystone species are any species whose removal or reduction from an ecosystem adversely affects the…
Q: 1. Which of the following is true? A. Carnivores eat both animals and plants B. Omnivores eat both…
A: Introduction :- A carnivore is an organism that eats predominantly meat or animal flesh. Carnivores…
Q: Which of the following is NOT one of the principal factors that sustains life on earth? - the…
A: Earth is the planet with life having a consistent flow of energy, water bodies and atmosphere that…
Q: Which of the following individuals would most benefit from a low sodiun O a. Joey is a 5 year old…
A: The World Health Organization recommends that adults decrease their sodium intake to decrease their…
Q: 13 ATLAS 14 (coudal view)
A: Atlas Vertebrae: 3. Transverse process 13 and 6.. Foramen transversarium 5. Foramen of dense 9.…
Q: Which of the following cells secretes the enzymes - gastric lipase and pepsin ogen? Group of answer…
A: Mucous neck cells: These basically located in gastric glands. These contain less mucin in apical…
Q: A C 18. What kind of potentials can be created at the arrow for A? a. Post-synaptic excitatory…
A: Neurons, also known as nerve cells, send and receive signals from your brain. While neurons have a…
Q: explain why there are more similarities between humans and chimpanees than between human and dogs.
A: Monkeys, chimpanzees, and humans are primate groups. Primates are vertebrates that are portrayed by…
Q: explain indole test, startch test and citrate test.
A: Indole test This is a biochemical test that is used to identify the capability of some bacteria to…
Q: Micelles are found Group of answer choices within the lumen of the small intestine within the…
A: Adoption of fat refers to the process whereby the end product of fat digestion passes through the…
Q: 4. Give three economic uses of monocot stems with specific plant example.
A: In monocots, epidermis is the outermost layer. Usually covered with thick layer of cuticle.…
Q: What population will be directly affected if the sea otters leave the kelp forest? Predict the…
A: Introduction The term "population" usually refers to the number of people living in a specific area,…
Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…
A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…
Q: Why did Carl Woese propose the domain Archaea? The domain Bacteria already had too many organisms in…
A: Carl Woese propose the three domain classification. He propose that all cellular life is divided…
Q: 10 Equipment use in Expanded Programme on Immunisation
A: Introduction Immunization:- It is the process of giving a vaccine to a person to protect them…
Q: Examples of ecological restoration include all of the following EXCEPT: - building levees to…
A: Introduction Ecological restoration:- It is the process of reversing the degradation of ecosystems…
Q: 1. Illustrate a brine floatation method. 2. What are the disadvantages and advantages in using a…
A: In the flotation method the attachment of bubbles to particles transfers the solids from the body of…
Q: How this Bacillus cereus can be find? what kind of testing require ? Is it through plate or brooth…
A: Bacillus cereus is a Gram-positive, rod-shaped, facultatively anaerobic, flagellated,…
Q: Which of the following individuals would most benefit from a low sodium diet? O a. Joey is a 5 year…
A: Introduction :- A systolic pressure of less than 120 and a diastolic pressure of less than 80 is…
Q: Which of the following pieces of evidence are used to construct a cloudogram? Choose all that apply.…
A: Introduction :- A cladogram is a diagramatic tool used in cladistics to depict how species are…
Q: Melanosomes are specialized lysosomes that storepigments for eventual release by exocytosis. Various…
A: Introduction Melanosomes are organelles that produce and store melanin, a common biological pigment…
Q: What is meant by the description "antiparellel" regarding the two strands that make up DNA?
A: DNA is a double stranded molecule which is composed of two long polynucleotide chains. A nucleotide…
Q: Below is a table that shows the changes in a population of domesticated rabbits. What is the most…
A: The rate of population expansion decreases and ultimately ceases as resources are depleted: this is…
Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…
A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…
Q: Identify the true statement(s) about global temperatures across Earth's history. (Note: may or may…
A: Given: Global temperature burden is increasing constantly around the globe. Earth's history has…
Q: . What is meant by a bacterial “colony” or colony-forming unit? 2. Why are colonies that develop on…
A: Since you've asked multiple questions, we're only answering the first three answers for you. If you…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotypeif the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAUDNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
- Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOPIllustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAAThe following is a strand of mRNA:CAA GUG AAA ACAHow many amino acids does the mRNA strand above code for?
- The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?A certain template DNA strand has the following nucleotide sequence: 3'—TACTGCATAATGATT—5' What would be the sequence of codons in the mRNA transcribed from this strand? What would be the nucleotide sequence of the complementary nontemplate DNA strand?DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.Complete the complementary strand: mRNA transcription ATTCGAGGCTAA