OCCURS IN WATER WITI 1. cobalt 2. strontium 3. selenium 4. vanadium

Q: In peas, tall stems & axial flowers are dominant to dwarf stems & terminal flowers, which are…

A: Mendel performed his experiment using pea plant. He described a plant have  two traits one is…

Q: The same chromosome can look very different depending on when in meiosis it is observed.  Explain…

A: Chromosomes appear very differently depending on where they are observed in the cell cycle.

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Which of the eight parents are definitely heterozygous for Type O Allele?

A: ABO blood grouping is a type of multiple allelism. The different type of alleles are -  Type A (IA)…

Q: Column 1 will list ALL characteristics you have identified or tested (include a Gram reaction, shape…

A: There are few important points that should kept in mind : As we know that bacteria are microscopic…

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…

A: Introduction :- Cytosine, along with adenine, guanine, and thymine, is one of the four nucleobases…

Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…

A: Lambda-DNA The lambda DNA is approximately 48502 base pairs in length.  It can be cleaved by 12…

Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.

A: The term homeostasis was given by Canon (1960). It is the mechanism by which stable chemical and…

Q: 13 ATLAS 14 (coudal view)

A: Atlas Vertebrae: 3. Transverse process 13 and 6.. Foramen transversarium 5. Foramen of dense 9.…

Q: 22 Complete the following statements to describe how to malntaln a balance between energy input and…

A: Answer

Q: Is the plant with the yellow flower above a eudicot or a monocot? What about the plant with the…

A: * The plant with yellow flower is comes under eudicot. * This yellow flower bearing plant is called…

Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…

A:

Q: Patients who are taking herbal remedies or dietary supplements do not need to list them on…

A: False...

Q: acillus cereus bacteria, in staining reaction tests, such as A.simple staining B.gram staining C.…

A: Answer

Q: is/are meristematic? -

A: INTRODUCTION Because plants are stationary, they have been given tissues made up of dead cells that…

Q: The pigments, energy reserve products, and cell walls found in land plants are also characteristic…

A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…

Q: Suppose gene B is X-linked and is embryonically lethal when homozygous or hemizygous recessive. A…

A: Let us first discuss the terms used in the question, Homozygous:- A condition when two copies of an…

Q: Cloning is the replication of all or part of an organism. Although cloning is still a developing…

A: Cloning is a technique scientists use to make exact genetic copies of living things. Genes, cells,…

Q: A distinguishing characteristic of Eukaryotes is that they contain membrane-enclosed organelles and…

A: The presence of a nucleus distinguishes eukaryotes from prokaryotes. Eukaryota is one of the three…

Q: Match each item with the correct statement below.         Nonpharmacologic methods to manage…

A: Introduction :- Both Crohn's disease and ulcerative colitis are inflammatory bowel diseases. Crohn's…

Q: Of the circled parts, indicate which numbers is/are parenchyma cells 1

A: There are various characters to be considered to indentify parenchyma cells. The major characters…

Q: To explain: Why the cancer treatments cause hair to fall out.

A: Cancer is a well known that they're supposed to define that they are condition in which cells grow…

Q: Parasitic alveolates that form spores at some stage in their life belong to which group? (a)…

A: * The answer of the question is option D that is apicomplexans. * Parasitic alveolates that form…

Q: Give an example of an industrial/clinical setting where quantifying viable bacteria would be useful.…

A: Quantifying viable bacteria is useful :-

Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…

A: The answer is option D.8.7×10 power 6.

Q: What hookworm penetrate into the skin and causes potbelly of malnutrition, microcytic and…

A: The Hookworm species which causes infection inside the human beings are ancylostoma duodenale and…

Q: In a particular dihybrid (T/t, B/b) the alleles of the "T and "B"genes indicated in the figure below…

A: Meiosis is a process where a single cell divides twice to produce four cells containing half the…

Q: D. Rectum 11. An eosinophil is classified as a A. Red blood cell B. White blood cell C. Platelet D.…

A: Blood contains many types of cells: white blood cells, red blood cells (erythrocytes), and…

Q: when XRCC2 DNA sequence CTC is changed to CCC (which causes a missense mutation converting Leu to…

A: The mutation is simply defined as a process in which the sequence of DNA of any organism changes.…

Q: Probably the best local example of primary ecological succession, and the place where Henry Cowles…

A: Ecological succession is the process of change in the species structure of an ecological community…

Q: To explain: The way in which the shortened telomeres affect the life-span of IPSCS and…

A: Stem cells are an undifferentiated mass of cells that can differentiate into specific cell types.…

Q: What is bacillus cereus ?

A: Microbes are the small sized organisms that can't be seen by naked eyes. The microscope is used to…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: Genetic code is the 3-letter combination of nucleotides, known as codon, each of which specifies to…

Q: Gel-filtration chromatography separates molecules according to their size . Smaller molecules…

A: Gel-filtration chromatography is a type of separation technique that uses a gel as a medium through…

Q: 9. Most species of Clostridium, which are widely distributed in the environment, are harmless to…

A: Infection is the entrance of pathogens into an organism's bodily tissues, their growth, and the host…

Q: Construct a schematic diagram on how ACE inhibition assay is performed based on the protocol given.…

A: k to library ACE Inhibition Assay Use in OneLab Abstract Overview Protocol Contact info OneLab is a…

Q: The example that relates to the law of supply and demand and mention the ways opted by the humans…

A: Natural resources provided by the biosphere meet the basic needs of over six billion people. Human…

Q: Choose an organism (plant or animal) and write its common name on the line below. Write the…

A: The earth's biosphere consists of many animals and plants and studying them individually is a…

Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…

A: Phylogenetic tree of vertebrates showing common ancestor.

Q: Based on the data below, which of the following statements best describes an effect of population…

A: Population density is defined as the number of individuals found in a particular area.

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: explain indole test, startch test and citrate test.

A: Indole test This is a biochemical test that is used to identify the capability of some bacteria to…

Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…

A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…

Q: What, generally, does the forest transition theory predict? Should its predictions bereceived as…

A: The terms 'eco' and 'system' allude to a region of the world and the coordinating entities,…

Q: 2. Consider the populations (1000 individuals) with the following genotypic frequencies: Population…

A: Note: As Per Guidelines, We Can Answer One Question or 3 sub parts of a question At A Time. Ask…

Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?

A: Chromosome is a long thread lie structure which comprises of hereditary units known as genes . These…

Q: Jimsom.  weed plants can produce purple or white flowers and spiny or smooth seed pods. A purple…

A: Given  Parent 1 phenotype - purple spiny Parent 2 phenotype - white spiny    Cross result 89 purple…

Q: A person with diabetes cannot regulate their blood sugar because their pancreas does not release…

A: If you have diabetes: Your glucose levels will continue to rise after you eat because there's not…

Q: What suggestions would you give for improving one’s immune system? Please explain the reasoning…

A: Immune system is very important for the proper functioning of body, without immune system our organs…

Q: Assuming that the histone octamer  forms a cylinder 9 nm in diameter and 5 nm in height and that the…

A: Introduction  The genome is an individual's complete set of genetic information that contains all of…