20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and peroxisome D. mitochondria, peroxisome and ER

Q: All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E°' for NAD+/NADH is -0.32 ...

A: NADH/FADH2 are also known as reducing equivalents. These reducing equivalents are produced in the gl...

Q: What are the other methods of detection for blood glucose determination? Explain the principle invol...

A: There are different methods for estimating the levels of glucose in the blood. The different methods...

Q: ODD MAN OUT. Which of the following is not related to the other choices below?     adenylyl cyclas...

A: All the mentioned components are involved in signal transduction.

Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids ...

A:  Hi! Since you have posted multiple question, we shall answer the first question for as we are only ...

Q: What is not an example of a reactive oxygen species (ROS)?   1. superoxide   2. hydroxyl radical...

A: Introduction: Reactive oxygen species are also referred to as free oxygen radicals. It is a highly r...

Q: What is the AG for the following reactions: ATP + H20 → ADP + P. AG= ADP + P → ATP + H20 AG =

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the firs...

Q: Based on the figure and the explanation in the textbook, what are the random chances that the di-sul...

A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124...

Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K without affectin...

A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...

Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...

A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the substrate...

Q: 3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton ...

A: As content of proton dissociable group presented in table, here we can count the charge status of di...

Q: ssume that you have radioactively labeled an amino acid in a glass of milk. Also assume that you hav...

A: Introduction: The term digestion refers to the integration of complex nutrients into simple, soluble...

Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...

Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...

A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...

Q: Describe the basic features of the DNA double helix

A: DNA is Deoxyribo Nucleic acid . This is the biomolecule that is responsible for heredity in almost a...

Q: Using G-25 Sephadex beads (Fractionation range 1000-5000) KD, a sample of Vitamin B12 (MW ~1500 KD) ...

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...

Q: What is the flow of genetic information?

A: Introduction:  The first direct evidence showing that the genetic material is DNA rather than RNA or...

Q: In SDS page, the ________ proteins will move through the gel fastest and first, and in size exclusio...

A: SDS-PAGE is biochemistry technique used to separate proteins based upon the relative mobility of cha...

Q: Explain the principle involved in blood typing.

A: The most significant blood typing is based on ABO groups, though 20 different blood groups are known...

Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...

Q: Given the following protein: N-MACHKGFDSTRRKYWQNKRLCVSA|IDWQSPWKNQGILV-C The overall charge of this ...

A: (1)The ionizable groups in the given peptide at pH 7 are; N-terminal : it will have +1 charge  Side...

Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K, without affecti...

A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...

Q: Arachidonic acids *   A. Linoleic polyunsaturated omega-6 fatty acid is its starting material. B. Sp...

A:        Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of ...

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...

A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...

Q: Which of the following saccharides is INCORRECTLY described? *       A. D-mannose: Monosaccharide: P...

A: Carbohydrates are macronutrients that the body requires for energy production. Carbohydrates provide...

Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower activ...

A: TRUE

Q: Among these amino acid combinations listed above, only the combination of Lys and Glu have side chai...

A: The tertiary structure of proteins are stabilized by non covalent interactions like hydrogen bonding...

Q: 1. Why is it important in Quantitative Analysis to postpone rounding until the calculation is comple...

A: A quantitative analysis is performed to detect the amount of specific substance in a sample solution...

Q: Protein solubility

A: here they are talking about protein solubility. Protein solubility is a thermodynamic property defin...

Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration chrom...

A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their isoe...

Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...

A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...

Q: How many H2O particles were produced by creating the following structure? * R H R R H-N-C,-c- -N-C,-...

A:               Amino acids are monomers of protein they are linked with each other by forming peptide...

Q: Are there any research involving white vinegar that it is effective as an ingredient in making insec...

A: Acetic acid is one of the most fundamental organic acids. In this context, "organic" refers to a che...

Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...

A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...

Q: What are the different mechanism of disease production?

A: The disease production mechanism identifies the likely source or causes of a problem/disorder, as we...

Q: 1.The 22nd amino acids and the only amino acid * A. Selenocysteine B. Selenicysteine C. Carbocystei...

A: Since you have asked multiple questions, we will solve only first question for you. If you want any ...

Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.

A: Given compound in a figure is Aspartame. It is an artificial sweetener and is made by dipeptide of a...

Q: What is the process and principle behind isoelectric precipitation?

A: Isoelectric precipitation is a type of isoelectric precipitation that occurs when: The pH of a solut...

Q: What characteristic makes each amino acid unique from one another?

A: Amino acids are organic compounds with functional group namely carboxyl and amino. There are 20 amin...

Q: Do we need to denature proteins? Why?

A: Heating, pH fluctuations, high concentrations of chemicals like urea, or reducing agents that break ...

Q: Enumerate the main structural features of nucleosides and nucleotides

A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic aci...

Q: Explain structural differences between an acidic amino acid and a basic amino acid. How does structu...

A:

Q: 6 Concanavalin (ConA) is a 25.5KDa protein with pI of 4.7 and optical absorbance (A 0.1% 289) of 1.1...

A: Proteins are polymers of amino acids with specific molecular weight and pI (isoelectric point, pH at...

Q: Q24. Choose the best answer for the following questions.

A: Amino acids are building blocks of proteins and also important as a precursor for the biosynthesis o...

Q: 1.Classify each protein as fibrous or globular. A. hemoglobin B. keratin C. myoglobin

A: Proteins are classified into two categories, on basis of shape and solubility.   1. FIBROUS PROTEINS...

Q: Which of the following factors favors the formation of the Random DNA Coil? a   Enthalpy b   Bas...

A: Some parts of the protein chain do not form regular secondary structure or have a consistent hydroge...

Q: Directionality of Polynucleotide chains originates at the  ____ end, and terminates at the  _____ en...

A:

Q: Discuss about enzymes: function, definition, and examples.

A:         At high temperatures, most of the enzymes denature and unfold similarly low temperatures als...

Q: electrical conductivity

A: Here they are talking about electrical conductivity. The counterpart of electrical resistivity is el...

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...

A: Glucose is converted to pyruvate through the process of glycolysis in the cytoplasm. The process of ...

Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps ...

A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all eukaryot...