3. How many amino acids are there in the polypeptide (protein)? Instructions: Provide brief answers to the following questions:1. How many codons are there in the Original DNA sequence?2. How many codons are there in the MRNA?3. How many amino acids are there in the polypeptide (protein)?4. How many codons are there in the mutated DNA-(b) and DNA-(c)?5. What types of mutations occurred in DNA-(b) and DNA-(c)?6. What codons are found in the MRNA for the two mutated DNA?7. What are the frequency and percentage distribution of amino acids in thepolypeptides coded by the Original DNA and the mutated DNA-(b) and DNA-(c)?8. What are the advantages and disadvantages of mutation? 1. DNA Sequencesa.) Original DNA 5'ATGCCTGGACGCAATGCGAGCTGGCTTA ACTCAGGG CGTTGA3'b.) Mutated DNA 5'ATGCCTGGGCGCAAGCGAGCTGGG TTACTCAAGGGGACGTTGA3'c.) Mutated DNA 5'ATGCGCGGACGCAAACGAGCTGGACTTCCGTCAGGGGTTCGA3'

Introduction :- Amino acids are molecules that join together to form proteins. The building blocks…

Answered: 3. How many amino acids are there in…

Science

Biology

3. How many amino acids are there in the polypeptide (protein)?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: 1. Why do we have to determine the molecular geometry of molecules?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Define and give there functions a. Carbohydrates b.polysaccharides

A: For the survival of living organisms, food is essential. The major components of food include…

Q: 3) Distinguish between the following substances: a) Nitrogenous bases and nucleotides

A: Deoxyribonucleic acid (DNA) is a double-stranded helical genetic material that contains thousands of…

Q: 3. How do each pair of the following molecules resemble/differ from each other. (a) glycogen and…

A: Monomers combine to form polymers. These all are carbohydrates. Carbohydrates are called so because…

Q: 3. What bonds are present in the formation of nucleotide and the binding of a nucleotide to another…

A: Nucleotides are the phosphoric acid esters of nucleosides. It occurs either as free form or as…

Q: 8) When a protein is not functional, it is said to be (1pts) denatured O recalibrated Oallocated O…

A: The building blocks of protein molecules are called amino acids. They are very small organic…

Q: 1. What are the main structural features of the polysaccharides starch? 2. How do this aids in its…

A: Starch is the primary carbohydrate source for growing seeds and for the development of leaf tissue.…

Q: 9. Describe the importance of DNA in determining the structure of a particular protein.

A: The DNA sequence (gene) is very important for the protein sequence, structure and function.…

Q: 3. Identify the amino acids contained in each of the following tripeptides. он он он || |…

A: Amino acids are the monomers of polypeptides that are linked by peptide bonds. A peptide bond is…

Q: 4. Which among the given peptides will form hydrogen bond with another similar peptide chain? i.…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 1. Which amino acid is the least hydrophobic? 2. Which amino acid is most hydrophobic? 3. Which…

A: Amino acids are the building block of proteins which interact with each other by peptide bonds.…

Q: 7. What type of bond is formed between the hydroxyl group of one nucleotide and the phosphate group…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: 1. What are Carbohydrates? How are they classified?

A: 1.Carbohydrates , proteins, nucleic acids such as DNA and RNA are all biomolecules. Biomolecules…

Q: Draw the structures of the amino acids tyrosine and aspartic acid

A: Amino acids are basically organic compounds. They are known to comprise amino and carboxyl…

Q: 2. How much ATP (energy) is produced from a protein that has 500 amino acids?

A: ATP are energy currency of the cell. They are produced in the mitochondria.

Q: 1. What do you think creates the unique shape of an enzyme?

A: Enzymes are the biocatalyst that increases the rate of a reaction. These enzymes are specific for…

Q: 3. What are the functions of lysine in human health?

Q: 2. How can a diet that is 90% carbohydrates support the same amount of protein in the human body as…

A: metabolism of carbohydrates

Q: 9. Which macromolecule would you eat if you wanted to help your body repair muscle? A. carbohydrate…

Q: 4. Which one of the following is NOT a nonessential amino acid? A. Alanine B. Cysteine C. Proline D.…

A: 4 Question) Which of the following is not a non essential aminoacid? Answer ) D. Methionine is a…

Q: What are the three major classes of carbohydrates? Describe each in one sentence

A: CARBOHYDRATES:- carbs, sugars molecules found in potatoes, rice, and many other food items.…

Q: 4. Identify each of the following vitamins as water-soluble of fat-soluble. a. Tocopherol b. Niacin…

A: A nutrient that can disintegrate in water. Water-solvent nutrients are conveyed to the body's…

Q: 3. Identify the biomolecules based on the given structures.

A: Biomolecules are carbon based organic compound produced by living organisms. Biomolecules primarily…

Q: 3. Why may it be difficult to formulate a ration to satisfy specific amino acid requirements for…

A: Ruminant animals (example; cow, camel, or goat) survive on a vegetarian diet. They eat plants like…

Q: 7. Hydrophobic amino acid (s) is/are: b. Asparagine d. Isoleucine a. Glutamine C. Leucine e. Valine

A: Amino acids are the building blocks of proteins , they combine to form polypeptides .

Q: Which statement BEST describes amino acids? Amino acids have an alpha carbon, amine group, fatty…

A: Amino acids are the building block of proteins. Different amino acids joined by peptide bonds and…

Q: 3. What would be the optimum pH for pepsin, an enzyme that breaks down protein in your stomach? Why?

A: ANSWER) The optimum pH for enzyme Pepsin is 2. At 2 pH Pepsin exhibits maximal activity.

Q: 2. How are the complex sugar molecules broken apart? 3. What substance are commonly called lipids?

A: When two monosaccharides are connected by glycosidic linkage, a disaccharide (also known as a double…

Q: 9. The function of a protein is determined primarily by:

A: Proteins are made up of amino acids. They have wide variety of functions to play in body. They act…

Q: 3) a) Research the chemical structure of maltose. How can you tell that it is a carbohydrate from…

A: Carbohydrate Carbohydrates are one of the type of macromolecule. It consists of carbon, hydrogen…

Q: 2. Summarize the major amino acids and their characteristics. 3. Give the characteristic features of…

A: Introduction: Amino acids are molecules that contain an amino group, a carboxylic acid…

Q: 4. What are coenzymes?

A: Introduction :- Small compounds called coenzymes cannot catalyse reactions on their own, but they…

Q: 3. What type of chemical bond maintains the carbon tail of lipids together?

A: The chemical compounds like proteins, carbohydrates, lipids, and nucleic acids are a mandatory…

Q: 3. What are the three classes of carbohydrates?

A: There are many Macromolecules required for our body to live .These Macromolecules include proteins ,…

Q: 3. When a protein is boiled, it loses all levels oforganization. When this happens, the protein is…

A: A protein is said to be hydrolyzed,when it derives its component amino acids and peptides and these…

Q: 2 What Role Does the Amino Acid Sequence Play in ProteinStructure?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: 4. Which of the following is the CORRECT pair of a protein and its function? * A. Hemoglobin: helps…

A: Proteins are biomolecules composed of amino acid units. Proteins are the building blocks of the…

Q: What are the main types of molecules classified as lipids?

A: A lipid is a material that is insoluble in water but soluble in alcohol, ether, and chloroform in…

Q: 1. What are the functions of carbohydrates?

A: Since you have posted multiple questions we will solve the first question for you. If you want any…

Q: Nucleic acids, proteins, and polysaccharides all share a similar structure. How is the structure of…

A: Biological macromolecule are the molecules that synthesize numerous elements of the cell , thus also…

Q: 1. What are carbohydrates?

A: (Note: According to guidelines, we are supposed to answer only one question. Please repost other…

Q: 1. Which of the following statements best describe lipids?

A: Lipids are organic compounds with hydrogen, carbon, and oxygen atoms that provide the structural and…

Q: 3. Which of the major types of biomolecules is never found in a polymeric form? A) amino acids B)…

A: Organic molecules rich in carbon, hydrogen, oxygen, nitrogen, ad phosphorus atoms, that function…

Q: 7) Draw the basic structure of a triglyceride (fat) and label the hydrophobic and hydrophilic ends.

A: Triglycerides are fats from the food we eat that are carried in the blood. They contain three fatty…

Q: 2. Which of the following structure is a triglyceride?

A: Triglycerides are formed by one glycerol and three fatty acids joined together by 3 ester bonds.

Q: 1. Why is it important to pay attention to essential amino acids if you are a vegetarian/vegan?

A: There are few important points about amino acids : Amino acids are the compounds that contain carbon…

Q: 1. What are the main biological functions of polysaccharides?

A: Polysaccharides are known to be one of the most abundant carbohydrates. They are essentially…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

3. How many amino acids are there in the polypeptide (protein)?

1. DNA Sequences
a.) Original DNA 5'ATGCCTGGACGCAATGCGAGCTGGCTTA ACTCAGGG CGTTGA3'
b.) Mutated DNA 5'ATGCCTGGGCGCAAGCGAGCTGGG TTACTCAAGGGGACGTTGA3'
c.) Mutated DNA 5'ATGCGCGGACGCAAACGAGCTGGACTTCCGTCAGGGGTTCGA3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.