5 3. The Lysine-rich (KKRPKPGG) octapeptide sequence has been shown to bind selectively to a class of mis-folded proteins referred to as the prion protein (Proc. Natl. Acad. Sci. USA 2007, 104, 11551-11556). Thus,KKRPKPGG peptides are useful agents in the detection of mis-folded proteins implicated inneurodegenerative diseases such as the Creutzfeldt-Jacobs Disease (VCJD) also known as mad-cow diseasein animals.(a) From the structrure of KKRPKPGG provided below, please name the amino acid residues fromthe N C terminus, identify the side-chain functionality according to polarity or potentiallyionic structure (i.e. acidic/basic, polar/non-polar etc.) and provide the stereochemicalconfiguration at each residue (i.e. D/R or L/S).H2NHN.NHHN=NH,HNHNKKRPKPGG(b) Prion mis-folding tends to occur by the formation of B-sheet aggregates. Describe the B-sheetsecondary structure in proteins, their potential for aggregation and a spectroscopic techniqueuseful for its characterization.(c) Interestingly, the mechanism of specific binding of KKRPKPGG to the mis-folded prion proteinhas been found to occur with a Lys residue on the peptide and a Glu residue on the protein(shown below). Describe the chemical nature of this bonding interaction.HNH-OLysGluKKRPKPGGprion protein

Proteins are polymers of amino acids linked by peptide/amide bonds with release of the water…

Answered: 3. The Lysine-rich (KKRPKPGG)…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 15TYK

See similar textbooks

Similar questions

1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.
1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it lead to amino acids substitution? Illustrate the process
1. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z+ y- a+ / i+ p+ oc z- y- a+ Answer choices UII UIC UUU ICC CUC IUC CCU 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z- y+ a+ / iS p+ o+ z- y+ a+ Answer choices ICC CCU UII IUC UIC CUC UUU
1.) Which of the following would be a good chemotherapy approach: blocking formation of the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP? Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTP are related to these and how loss of the particular molecule would affect each process. A.) PEP carboxykinase in gluconeogenesis B.) Succinyl-CoA synthetase in the TCA Cycle C.) Glucagon signal transduction
An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
5a The two factors that bind directly to the DNA at Pacific sequences are TFIID and TFIIB- in general terms what is the function of each of these two transcription factors in the initiation of transcription This is not a graded question and it will never be graded, This is for studying purpose only
1. With reference to the figure, discuss the results of the Western Blotting experiments, what they tell you about the behaviour of the estrogen receptor, and how this relates to its known biological activity. 2. Propose what suitable controls should be included for this experiment and explain what you would expect to see as results from these controls in the Western Blot in the figure.
1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an enzyme? What function does this protein serve? If necessary, you may include a mechanism.
2) How does the HAEIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS