3.What is the relationship between surface properties and immune response? What are some tests that can be done to measure the described surface properties?

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: You give a good overview of sexual and asexual reproduction in fungi. However, which one is more…

A: Fungi can reproduce both sexually and asexually. Imperfect fungus reproduce only asexually, whereas…

Q: RNA to DNA, Ribosome, cytoplasm DNA, nucleus, cytoplasm Proteins, Nucleus, ribosome Proteins,…

A: The process through which cellular ribosomes produce proteins is known as translation. A ribosome…

Q: What are the monoclonal antibodies: a) antibodies produced in one animal; b) antibodies delivered in…

A: Antibodies are specialised Y shape proteins that binds  to the foreign invaders -whether they are…

Q: 1. Length of fur is also genetically determined. The allele L produces long fur and its…

A: * Given that Length of fur is Genetically determined. *The allele L produce long fur and another…

Q: 32. dna methylation can change the degree of condensation of the chromatin   identify which…

A: ANSWER) (b) transcriptional control DNA methylation can change the degree of condensation of the…

Q: Describe how you would go about step-wise using the biotechnology available (RNA sequencing, PCR,…

A: The most efficient strategy for disease prevention and control is vaccination, which involves the…

Q: How does KU proteins promote DNA repair during mitosis? Explain.

A: The Ku proteins bind to the linear phage DNA ends and induce LigD to ligate the ends, resulting in a…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: The lysis of erythrocytes is known as hemolysis and the enzyme catalyzing this reaction is called…

Q: Briefly describe the relationship between photosynthesis and respiration in terms of the reactants…

A: Introduction Photosynthesis is the process by which green plants use sunlight, carbon-dioxide…

Q: What is the continuous challenge that the influenza virus presents toscientists and public health…

A: Influenza refers to an acute respiratory illness that spreads from zoonotic reservoirs among aquatic…

Q: a separate sheet of paper. 3 MONTHS MONTHS MONTHS MONTHS 6 MONTHS 5 MONTHS PROCESS: FETAL…

A: Humans are sexually reproducing and Vviparous. The reproductive events in humans inciude formation…

Q: What Characteristics of Phosphorous minerals makes them suitable to be used as fertilizers?

A: Most common form of phosphorus is Diammonium phosphate and monammonium phosphate,NPK etc. NPKs is a…

Q: Which of the following was part of the ozone depletion problem? O Mining waste Chlorofluorocarbons…

A: The thinning of the ozone layer in the upper atmosphere is referred to as ozone layer depletion.…

Q: 13. The presence of freckles (F) is dominant to no freckles (f). Jake and his mom have freckles, but…

A: Introduction The term "genotype" refers to an organism's whole complement of genes; in other words,…

Q: Match each structure with its description.___ cloaca                   a. adjusts buoyancy___ swim…

A: Any biological thing which takes up space and is distinct from its environment is referred to as an…

Q: Presence of proximal and distal promoters in Drosophila melanogaster for alcohol dehydrogenase. Is…

A: Drosophila melanogaster is a species of fly in the family Drosophilidae. The species is often…

Q: Evaluate whether the statements I and II are TRUE or FALSE.

A: Euchromatin is the light staining and less condensed portions of chromatin. This region is…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: Instructions: Answer the following problem using the punett square and identify its Genotypic ratio…

A: Allele is the alternative pairs of genes that occupy a specific location on homologous chromosome…

Q: 4. White fruit color in summer squash is dependent on a dominant gene (W) and colored fruit to the…

A: In this cross, the recessive allele of one gene masks the effects of either allele of the second…

Q: What are the key steps of transformation, tumorigenesis and metastasis on a cellular and tissue…

A: Transformation is a process in which a normal cell is transform into a cancerous cell  Tumor genesis…

Q: Which of the following best describes a feature/s of fats that makes them an ideal energy storage…

A: *Lipids are one of the four biological macromolecules which perform many functions in different…

Q: How are concatemers of the Herpes Virus resolved to make sure only a single copy of the genome is in…

A: Herpes virus is very notorious for causing various types of infections which are very hard to treat…

Q: Describe the freshwater, marine, and coastal portionsof the interconnected aquatic system

A: Freshwater habitats can be defies the water with concentration less than 1 percent salt whereas…

Q: in the fruit fly, genes for rRNA can be replicated more or less often compared to the rest of the…

A: The regulation of the quantities of protein generated from its mRNA is known as translational…

Q: 3.Histamine is a signaling molecule that plays a significant role in regulating immune responses…

A: Histamine is a nitrogenous organic molecule that has a role in local immunological responses, as…

Q: What is a hominin? an order of primates a family of greater apes a family of human-like apes a clade…

A: Hominin refers to any member of the tribe Hominine, which includes all modern and extinct people and…

Q: How does hydrochloric acid aid in the digestion of food?     Hydrochloric acid breaks down the…

A: HCl helps in digestion of protein. It protects body from infection.

Q: Human Papillomaviruses has of many strains. Some of them cause warts while others can cause cancer.…

A: *Human papillomaviruses are type of viruses that causes abnormal tissue growth and cause other…

Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…

A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…

Q: Are there differences in monocot and dicot seeds?  Tabulate the differences (if any)

A: Angiosperms or flowering plants are broadly classified into two main groups - monocotyledons and…

Q: Describe cancer cell types and the differentiation process that occurs during cancer development.

A: Cancer cells are very notorious for causing high Morbidity and mortality among patients of various…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: WHAT IS Humoral Immunity

A: Active immunity is the immunity induced in entities by the exposure of antigens. It is mediated by…

Q: The figure above shows succession in an ecosystem. What organisms are found in the climax community…

A: The steady and orderly transformation of an ecosystem caused by the gradual replacement of one…

Q: Male bowerbirds construct elaborate nests in order to attract females. Different species of…

A: The reproductive isolation mechanisms are a group of evolutionary mechanisms, cognitive, and…

Q: After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…

A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…

Q: Describe the processes of cellular signaling and metabolism that are altered during the…

A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…

Q: which is an unseen factor that affects the carrying capacity of the ocean?   1. water chemistry…

A: The carrying capacity of an environment refers to the highest number of biomass of living organisms…

Q: Which method provides the most accurate evidence for scientists to use when determining evolutionary…

A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…

Q: this assignment let us assume that your class are a group of expert biologist task with…

A: Various animals have variety of weaknesses which can be exploited based on the knowledge about…

Q: Many antibiotics used in modern medicine are compounds made by fungi that inhibit bacterial protein…

A: Introduction Antimicrobials are medications that treat diseases caused by microbes, these are agents…

Q: Alternative splicing of the same pre-mRNA produces two isoforms.

A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…

Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…

A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…

Q: 12.Which is also known as the "voice box" which regulates the air flow into the lungs? Read and…

A: The respiratory system is a network or organs and tissues that help in gaseous exchange i.e., take…

Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev

A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…

Q: Illustrate the schematic diagram of polymorphic DNA

A: DNA polymorphisms include: (1) RFLP – restriction fragment length polymorphism; (2) VNTR – variable…

Q: how has human evolution changed or not chnged your concept of what it means to be human? (restrict…

A: Evolution is a process of change to adapt accordingly to the environment for better survival and…

Q: Preserved remains of animals e.g. bones and shells are examples of trace fossils

A: Fossils are the remains, tracks, impressions, or evidence of ancient species. These are conserved…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.