32. Would you expect to find hydrophobic amino acids on the external surface or internally in proteins? Why? 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)? many intermearat only partially replicated. Thus, Meselson and Stahl's experiments showed that DNA replication IS a semiconservative process in which the single strands of the double helix remain intact (are conserved) during a replication process that distributes one parental strand into each of the two daughter molecules (thus the te uonry NOTES

32. Would you expect to find hydrophobic amino acids on the external surface or internally in proteins? Why? 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)? many intermearat only partially replicated. Thus, Meselson and Stahl's experiments showed that DNA replication IS a semiconservative process in which the single strands of the double helix remain intact (are conserved) during a replication process that distributes one parental strand into each of the two daughter molecules (thus the te uonry NOTES

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
How did Meselson and Stahl support Watson and Crick’s double-helix model? They demonstrated that each strand serves as a template tor synthesizing a new strand of DNA They showed that the DNA strands break and recombine without losing genetic material They proved that DNA maintains a doublehelix structure while undergoing semiconservative replication They demonstrated that conservative replication maintains the complementary base pairing of each DNA helix.
1. DNA plays an important role in two processes. During the process of replication, dna provides information to copy itself, so genetic information can be passed on from one generation of cells to the next. DNA also provides instructions for making proteins, in these instructions are vital to the maintenance and function of cells. DNA provides the information on how to order the amino acids required for making various proteins. Describe the significance of crude extraction of DNA from different sample organismic. 2. Distinguish the importance of the following theorems that are interrelated to the study of bioinformatics: (1) proteomics, (2) genomics, (3) biotechnology, (4) biostatistics, and (5) biological engineering. 3. Describe the procedures that you have encountered in the bacterial identification virtual laboratory (media.hhmi.org). Describe each part of the procedure: (1) simple preparation, (2) PCR amplification, (3) PCR purification, (4) sequencing preparation, (5) DNA…
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
4. In bacterial cells, nucleotide excision repair involves which of the following proteins?A. DNA glycosylaseB. AP endonucleaseC. photolyaseD. AlkBE. UvrABC proteins 5. If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is:A. constructiveB. semiconservativeC. conservativeD. consecutiveE. cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair?A. DNA polymerase IB. DNA polymerase IIC. DNA polymerase IVD. DNA polymerase VE. none of the above
DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?
5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.
22. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices 1. 5' TTACCGAAT 3' 2. 3′ TTACCGAAT 5′ 3. 5′ TAAGCCATT 3′ 4. 3′ AATGGCTTA 5′
3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this makes sense in terms of the structure of DNA? Group of answer choices A, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is not favored in DNA helix. B, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is favored in DNA helix. C, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is not favored in DNA helix. D, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is favored over A-T binding in DNA helix.
1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure of a pyrimidine dimer and explain why the formation of such aberrant structures results in tumor-enabling genomic instability. 2. Use your own words to define ultraviolet light. Include a comparison of naturally-occurring vs artificial UV. What is UV-A? UV-B? UV-C? Which one(s) is (are) the most damaging to DNA? Why? Which one(s) are most likely to lead to a mutation in skin cells? Why? What type of UV light is used in tanning beds?
1. DNA polymerase I has both a 5' to 3' exonuclease activity and a 3' to 5' exonuclease activity. Briefly describe what each of these exonuclease functions is used for during DNA replication and why it is necessary.