Need help in 1 & 2And if possible Analysis 1,2,&3 1. Imagine that you are analyzing a DNA sample from theliver tissue of a newly discovered species of mouse. Usethe information in the table below to complete thenucleotide composition of your sample.Analysis1. Explain what you would expect to find if you comparedthe nucleotide composition of your DNA sample withthe nucleotide composition of a second DNA samplefrom the muscle tissue of the same mouse.NucleotidePresence in DNA sample (percent)adenine312. Would the nucleotide composition of your original DNAsample be different from the nucleotide composition ofa tissue sample from the gametes of the same mouse?Explain your answer.cytosineguaninethymine3. Would the nucleotide composition of your original DNAsample be different from the nucleotide composition of atissue sample from the liver of a deer? Explain your answer.2. Draw a linear stretch of a double-stranded DNAmolecule about 20 base pairs long, with a nucleotidecomposition that corresponds (as closely as you can)

Since you have asked multiple question, and need help in 1 & 2, we will solve the first and…

1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species of mouse. Use the information in the table below to complete the nucleotide composition of your sample. Nucleotide Presence in DNA sample (percent) adenine 31 cytosine guanine thymine 2. Draw a linear stretch of a double-stranded DNA molecule about 20 base pairs long, with a nucleotide composition that corresponds (as closely as you can)

1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species of mouse. Use the information in the table below to complete the nucleotide composition of your sample. Nucleotide Presence in DNA sample (percent) adenine 31 cytosine guanine thymine 2. Draw a linear stretch of a double-stranded DNA molecule about 20 base pairs long, with a nucleotide composition that corresponds (as closely as you can)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference
1. The image below shows the base cytosine and a methylated form of cytosine that occurs frequentlyin the human genome. Use your knowledge of DNA structure to answer these questions: a. Does methylation of cytosine affect its ability to base-pair with guanine? Explain. b. Could methylation of cytosine affect the binding of a protein that interacts with a C-G basepair in the major groove? Explain your answer.
1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at your container? 2. Is the DNA you extracted pure? What are the possible impurities? 3. What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this.
1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)
1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?
For each of the restriction enzymes listed below:(i) Approximately how many restriction fragmentswould result from digestion of the human genome(3 × 109bases) with the enzyme? (ii) Estimate theaverage size of the pieces of the human genomeproduced by digestion with the enzyme. (iii) Statewhether the fragments of human DNA produced bydigestion with the given restriction enzyme wouldhave sticky ends with a 5′ overhang, sticky endswith a 3′ overhang, or blunt ends. (iv) If the enzymeproduces sticky ends, would all the overhangs on allthe ends produced on all fragments of the humangenome with that enzyme be identical, or not? (Therecognition sequence on one strand for each enzymeis given in parentheses, with the 5′ end written atthe left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage.)a. Sau3A (^GATC)b. BamHI (G^GATCC)c. HpaII (C^CGG)d. SphI (GCATG^C)e. NaeI (GCC^GGC)f. BanI (G^GYRCC)g. BstYI…
Watch the demonstration video on nucleic acid quantification on the NanoDrop spectrophotometer: https://cutt.ly/bio150dnaquantification Note: the video is entitled RNA but the method is identical for DNA quantification. 1. At what ratio of A260/280 can we say that DNA is pure? What about RNA and protein?2. While spectrophotometric methods are effective at detecting DNA, a more sensitive but expensive technique called fluorometry is used in sensitive applications. What is the principle behind fluorometry and why is it better than spectrophotometry in detecting DNA?
If we extract DNA of a pool of cells, will that impact the DNA sequencing? In other words, having more than one cell will affect the DNA sequence of our sample? Same as 1, but with RNA. Cite one problem you expect when investigating a pool of cells.
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
By mistake, you add two primers to your DNA sequencing reaction. The primers anneal on the same strand but 20 bases apart. Which of the following best describes how your sequence will look?A. The sequence will be readable for the first 20 bases only.B. The detector will detect two nucleotides at about 75% of the positions.C. The sequence will be readable for the last 20 bases only.D. The detector will detect one nucleotide at about 75% of the positions.E. The detector will detect no nucleotides at any of the positions. Explain why it is B.
1.) What characteristics of VNTR and STR make them useful for DNA fingerprinting? 2.) How does PCR minimize the problems associated with degraded DNA? 3.) What factors can cause DNA to become degraded? 4.) If Ethidium bromide was not added to a gel, what would happen? 5.) How can you tell if an individual is heterozygous for the D1S80 marker? 6.) If a negative control produces a band, what does this indicate? 7.) In an experiment, a student’s sample amplified for D1S80 produced 3 bands. It was the only DNA sample run on the gel. The student knows that there was no problem with the Thermocycler or primers because the other students in the class had the expected results of only one or two bands. What is the most likely explanation for these results?