1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA does the process begin? How many DNA strands are used as template strands? What is the main enzyme used for polymerization of the nucleic acid? What type of bond is formed in the new nucleic acid polymer? Is the process continuous from beginning to end of the new sequence or discontinuous (making short sequences)? Is an RNA primer used? Which 5 C sugar is used within the nucleotides during this process? What terminates the process in eukaryotic cells?

1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA does the process begin? How many DNA strands are used as template strands? What is the main enzyme used for polymerization of the nucleic acid? What type of bond is formed in the new nucleic acid polymer? Is the process continuous from beginning to end of the new sequence or discontinuous (making short sequences)? Is an RNA primer used? Which 5 C sugar is used within the nucleotides during this process? What terminates the process in eukaryotic cells?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.