Terminators The addition of an excess of ddNTP leads to the stop of DNA replication in bacteria: explain the biochemistry behind this process (hint: the chemical structures of NTP, DNTP and ddNTP are shown below). "o- "o-P-o "o-P-o "o-p-o "o-p-o "o-P-o "o-P-o "o--o Base Base Base CH, CH, CH, H. H. H H. H. он он OH H Ribonucleoside triphosphate NTP) Deoxyribonucleoside triphosphate (dNTP) Dideoxyribonucleoside triphosphate iddNTP)

Terminators The addition of an excess of ddNTP leads to the stop of DNA replication in bacteria: explain the biochemistry behind this process (hint: the chemical structures of NTP, DNTP and ddNTP are shown below). "o- "o-P-o "o-P-o "o-p-o "o-p-o "o-P-o "o-P-o "o--o Base Base Base CH, CH, CH, H. H. H H. H. он он OH H Ribonucleoside triphosphate NTP) Deoxyribonucleoside triphosphate (dNTP) Dideoxyribonucleoside triphosphate iddNTP)

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?
A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3 undergoes DNA replication in vitro in the presence of all four nucleotides plus an amount of dideoxyadenosine triphosphate sufficient to compete for incorporation with deoxyadenosine triphosphate. How many and what DNA fragments are expected?
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)
DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds. What is the activated intermediate in the linkage reaction catalyzed by each of these enzymes? What is the leaving group?
Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
A chemotherapeutic agent can seek to prevent successful replication. How could a nucleotide with a -NH3 (azido group) at 3' position be used to treat cancer, a disease caused by excess cell division?
Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it. a. Ribonuclease requires two active site histidines to be active but the nucleobase of DNA will form hydrogen bonds with these histidines and block their acid-base catalysis. b. DNAs have thymidine that is more stable than the uracil in RNAs c. DNAs are double-stranded and the nucleobases are protected while RNAs are single stranded d. DNAs does not have hydroxyl group at 2' position of the sugar ring to support the catalysis
A reaction mixture contains DNA polymerase, the four dNTPs, and one of the DNA molecules whose structure is represented below. Which reaction mixtures generate PPi?
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?